From d44f0879d277582380b3aef003dcd65fe1bd6e6a Mon Sep 17 00:00:00 2001
From: Luis Mochan <mochan@fis.unam.mx>
Date: Tue, 8 Dec 2020 22:37:13 -0600
Subject: Add solutions to challenge 90

---
 challenge-090/wlmb/perl/ch-1.pl | 64 +++++++++++++++++++++++++++++++++++++++++
 challenge-090/wlmb/perl/ch-2.pl | 40 ++++++++++++++++++++++++++
 2 files changed, 104 insertions(+)
 create mode 100755 challenge-090/wlmb/perl/ch-1.pl
 create mode 100755 challenge-090/wlmb/perl/ch-2.pl

diff --git a/challenge-090/wlmb/perl/ch-1.pl b/challenge-090/wlmb/perl/ch-1.pl
new file mode 100755
index 0000000000..00e54fa1e0
--- /dev/null
+++ b/challenge-090/wlmb/perl/ch-1.pl
@@ -0,0 +1,64 @@
+#!/usr/bin/env perl
+# For sequences of DNA get nucleotide counts and its complement
+
+use strict;
+use warnings;
+use v5.10;
+
+use List::Util qw(sum0);
+
+# Receive sequences as strings in @ARGV
+say('Usage: ch-1.pl sequence1 sequence2 ...'), exit 1 unless @ARGV;
+
+my %complement_of; # Map dna nucleotide to its complement
+@complement_of{my @nucleotides=qw(T A G C)}=qw(A T C G); #initialize
+
+foreach my $sequence(map {uc} @ARGV){
+    say("Wrong sequence $sequence"), next unless $sequence=~/^[@nucleotides]*$/;
+    say "  Sequence: $sequence";
+    say "Complement: ", complement($sequence);
+    my %count_for=get_count_for($sequence);
+    say "Nucleotide counts:";
+    say "\t$_-$complement_of{$_} $count_for{$_}" for @nucleotides;
+    say "\tTotal\t", sum0 values %count_for;
+}
+
+sub complement { # converts string with a DNA sequence to its complement
+    my $sequence=shift;
+    return join "", map {$complement_of{$_}} split //, $sequence;
+}
+
+sub get_count_for { # count nucleotides of a dna sequence
+    my $sequence=shift;
+    my @nucleotides=split //,$sequence;
+    my %count_for; # counts of nucleotides
+    @count_for{split //, "TAGC"}=((0) x 4); #initialize with 0's
+    map {$count_for{$_}++} split //, $sequence;
+    return %count_for;
+}
+
+# Sample run:
+#
+# $ ./ch-1.pl hithere \
+# GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG \
+# TGCTGGTCGCCG
+#
+# yields:
+#
+# Wrong sequence HITHERE
+#   Sequence: GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG
+# Complement: CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC
+# Nucleotide counts:
+#         T-A 22
+#         A-T 14
+#         G-C 13
+#         C-G 18
+#         Total   67
+#   Sequence: TGCTGGTCGCCG
+# Complement: ACGACCAGCGGC
+# Nucleotide counts:
+#         T-A 3
+#         A-T 0
+#         G-C 5
+#         C-G 4
+#         Total   12
diff --git a/challenge-090/wlmb/perl/ch-2.pl b/challenge-090/wlmb/perl/ch-2.pl
new file mode 100755
index 0000000000..6be0c0de39
--- /dev/null
+++ b/challenge-090/wlmb/perl/ch-2.pl
@@ -0,0 +1,40 @@
+#!/usr/bin/env perl
+# Multiply two numbers using the Ethiopian Multiplication
+
+use strict;
+use warnings;
+use v5.10;
+use integer;
+use List::Util qw(all);
+
+# receive the two numbers in @ARGV
+die 'Usage: ./ch2.pl number1 number2' unless @ARGV==2;
+my ($x, $y)=@ARGV;
+die 'Expected two non-negative integers'   # check signs
+    unless all {int($_)==$_ && $_>=0} ($x, $y);
+my $expected_result=$x*$y;
+my $result=0;
+my $result_string="$x x $y = ";
+my $operator="";
+while($x){
+    if($x&1){  # $x is odd, add $y to result
+	print "->"; # flag line
+	$result += $y;
+	$result_string .= "$operator 1 x $y";
+    } else {   # $x is even, don't add y
+	$result_string.="$operator 0 x $y";
+    }
+    say "\t$x\t$y";
+    $operator=" + ";
+    $x>>=1;  # Divde $x by 2
+    $y<<=1;  # Multiply $y by 2
+}
+say " $result_string = $result (Expected: $expected_result)";
+
+# Sample run:
+# $ ./ch-2.pl 11 23
+# ->      11      23
+# ->      5       46
+#         2       92
+# ->      1       184
+#  11 x 23 =  1 x 23 +  1 x 46 +  0 x 92 +  1 x 184 = 253 (Expected: 253)
-- 
cgit