From 6fd63feb846f57024642ed6c7a98f4a6e0c03816 Mon Sep 17 00:00:00 2001
From: Simon Proctor <simon.proctor@zoopla.co.uk>
Date: Mon, 7 Dec 2020 09:05:11 +0000
Subject: Challenge 90

---
 challenge-090/simon-proctor/raku/ch-1.raku | 27 +++++++++++++++++++++++++++
 challenge-090/simon-proctor/raku/ch-2.raku | 17 +++++++++++++++++
 2 files changed, 44 insertions(+)
 create mode 100644 challenge-090/simon-proctor/raku/ch-1.raku
 create mode 100644 challenge-090/simon-proctor/raku/ch-2.raku

diff --git a/challenge-090/simon-proctor/raku/ch-1.raku b/challenge-090/simon-proctor/raku/ch-1.raku
new file mode 100644
index 0000000000..b20646d40b
--- /dev/null
+++ b/challenge-090/simon-proctor/raku/ch-1.raku
@@ -0,0 +1,27 @@
+#!/usr/bin/env raku
+
+use v6;
+
+my $sequence = "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG";
+
+say nucleotide-count( $sequence );
+say complement( $sequence );
+
+sub nucleotide-count(  $sequence ) {
+    my @cytosines = $sequence.comb;
+    my @nucleotide;
+    my $count = 0;
+    
+    for @cytosines -> $cytosine {
+        @nucleotide.push($cytosine);
+        if ( all( "G", "T", "A", "C" ) (elem) @nucleotide ) {
+            $count++;
+            @nucleotide = ();
+        }     
+    }
+    return $count;
+}
+
+sub complement( $sequence ) {
+    with $sequence { return TR/TAGC/ATCG/; }
+}
diff --git a/challenge-090/simon-proctor/raku/ch-2.raku b/challenge-090/simon-proctor/raku/ch-2.raku
new file mode 100644
index 0000000000..a15b088f50
--- /dev/null
+++ b/challenge-090/simon-proctor/raku/ch-2.raku
@@ -0,0 +1,17 @@
+#!/usr/bin/env raku
+
+use v6;
+
+#| Given two Integers demonstrate Ethiopian Multiplication with them
+sub MAIN ( UInt $A is copy, UInt $B is copy ) {
+    my @parts;
+    say "Given $A and $B {$A %% 2 ?? '' !! '*'}";
+    @parts.push($B) unless $A %% 2;
+    while ( $A > 1 ) {
+        $A div= 2;
+        $B *= 2;
+        say "Got $A and $B {$A %% 2 ?? '' !! '*'}";
+        @parts.push($B) unless $A %% 2;
+    }
+    say "Adding {@parts.join(",")} to get {[+] @parts}";
+}
-- 
cgit 


From b60693356e3c00112901af37b26f19babfc6fa4d Mon Sep 17 00:00:00 2001
From: Simon Proctor <simon.proctor@zoopla.co.uk>
Date: Mon, 7 Dec 2020 09:11:17 +0000
Subject: Doh

---
 challenge-090/simon-proctor/raku/ch-1.raku | 13 +------------
 1 file changed, 1 insertion(+), 12 deletions(-)

diff --git a/challenge-090/simon-proctor/raku/ch-1.raku b/challenge-090/simon-proctor/raku/ch-1.raku
index b20646d40b..62d13ce95c 100644
--- a/challenge-090/simon-proctor/raku/ch-1.raku
+++ b/challenge-090/simon-proctor/raku/ch-1.raku
@@ -8,18 +8,7 @@ say nucleotide-count( $sequence );
 say complement( $sequence );
 
 sub nucleotide-count(  $sequence ) {
-    my @cytosines = $sequence.comb;
-    my @nucleotide;
-    my $count = 0;
-    
-    for @cytosines -> $cytosine {
-        @nucleotide.push($cytosine);
-        if ( all( "G", "T", "A", "C" ) (elem) @nucleotide ) {
-            $count++;
-            @nucleotide = ();
-        }     
-    }
-    return $count;
+    return $sequence.comb.Bag.pairs.sort( *.value ).reverse.map( -> $p { "{$p.key} : {$p.value}" } ).join("\n"); 
 }
 
 sub complement( $sequence ) {
-- 
cgit