From fa5731052dcccec7fd0c77d96266690d2841b815 Mon Sep 17 00:00:00 2001
From: Tyler Wardhaugh <tyler.wardhaugh@gmail.com>
Date: Mon, 7 Dec 2020 12:06:06 -0800
Subject: Ch90: prep for challenge

---
 challenge-090/tyler-wardhaugh/clojure/README.md | 10 +++++-----
 challenge-090/tyler-wardhaugh/clojure/deps.edn  | 10 +++-------
 challenge-090/tyler-wardhaugh/clojure/pom.xml   | 24 +++++++-----------------
 challenge-090/tyler-wardhaugh/lua/README.md     |  6 +++---
 4 files changed, 18 insertions(+), 32 deletions(-)

(limited to 'challenge-090')

diff --git a/challenge-090/tyler-wardhaugh/clojure/README.md b/challenge-090/tyler-wardhaugh/clojure/README.md
index f5a89af18d..41000b8199 100644
--- a/challenge-090/tyler-wardhaugh/clojure/README.md
+++ b/challenge-090/tyler-wardhaugh/clojure/README.md
@@ -1,13 +1,13 @@
-# tw.weekly.c89
+# tw.weekly.c90
 
 
-The Weekly Challenge - #089 - Tyler Wardhaugh
+The Weekly Challenge - #090 - Tyler Wardhaugh
 
 ## Usage
 
 Run the project directly (shows default output from both tasks):
 
-    $ clojure -M -m tw.weekly.c89.core
+    $ clojure -M -m tw.weekly.c90.core
 
 Run the project's tests (which are samples from the task descriptions):
 
@@ -15,11 +15,11 @@ Run the project's tests (which are samples from the task descriptions):
 
 Run Task #1 with input
 
-    $ clojure -M -m tw.weekly.c89.t1 N
+    $ clojure -M -m tw.weekly.c90.t1 DNA
 
 Run Task #2:
 
-    $ clojure -M -m tw.weekly.c89.t2
+    $ clojure -M -m tw.weekly.c90.t2 A B
 
 ## Project Template
 
diff --git a/challenge-090/tyler-wardhaugh/clojure/deps.edn b/challenge-090/tyler-wardhaugh/clojure/deps.edn
index cfd5d782d1..1fae9ef933 100644
--- a/challenge-090/tyler-wardhaugh/clojure/deps.edn
+++ b/challenge-090/tyler-wardhaugh/clojure/deps.edn
@@ -1,9 +1,5 @@
 {:paths ["src" "resources"]
- :deps {org.clojure/clojure {:mvn/version "1.10.1"}
-        org.clojure/core.logic {:mvn/version "1.0.0"}
-        org.clojure/math.combinatorics {:mvn/version "0.1.6"}
-        org.clojure/math.numeric-tower {:mvn/version "0.0.4"}
-        org.clojure/tools.macro {:mvn/version "0.1.2"}}
+ :deps {org.clojure/clojure {:mvn/version "1.10.1"}}
  :aliases
  {:test {:extra-paths ["test"]
          :extra-deps {org.clojure/test.check {:mvn/version "1.0.0"}}}
@@ -14,5 +10,5 @@
    :main-opts ["-m" "cognitect.test-runner"
                "-d" "test"]}
   :uberjar {:extra-deps {seancorfield/depstar {:mvn/version "1.0.94"}}
-            :main-opts ["-m" "hf.depstar.uberjar" "tw.weekly.c88.jar"
-                        "-C" "-m" "tw.weekly.c88"]}}}
+            :main-opts ["-m" "hf.depstar.uberjar" "tw.weekly.c90.jar"
+                        "-C" "-m" "tw.weekly.c90"]}}}
diff --git a/challenge-090/tyler-wardhaugh/clojure/pom.xml b/challenge-090/tyler-wardhaugh/clojure/pom.xml
index 3097f51f8e..bc8a82e4cd 100644
--- a/challenge-090/tyler-wardhaugh/clojure/pom.xml
+++ b/challenge-090/tyler-wardhaugh/clojure/pom.xml
@@ -2,11 +2,11 @@
 <project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd">
   <modelVersion>4.0.0</modelVersion>
   <groupId>tw.weekly</groupId>
-  <artifactId>tw.weekly.c89</artifactId>
+  <artifactId>tw.weekly.c90</artifactId>
   <version>0.1.0-SNAPSHOT</version>
-  <name>tw.weekly.c89</name>
-  <description>Challenge #089</description>
-  <url>https://github.com/tw.weekly/tw.weekly.c89</url>
+  <name>tw.weekly.c90</name>
+  <description>Challenge #090</description>
+  <url>https://github.com/tw.weekly/tw.weekly.c90</url>
   <licenses>
     <license>
       <name>Eclipse Public License</name>
@@ -19,9 +19,9 @@
     </developer>
   </developers>
   <scm>
-    <url>https://github.com/tw.weekly/tw.weekly.c89</url>
-    <connection>scm:git:git://github.com/tw.weekly/tw.weekly.c89.git</connection>
-    <developerConnection>scm:git:ssh://git@github.com/tw.weekly/tw.weekly.c89.git</developerConnection>
+    <url>https://github.com/tw.weekly/tw.weekly.c90</url>
+    <connection>scm:git:git://github.com/tw.weekly/tw.weekly.c90.git</connection>
+    <developerConnection>scm:git:ssh://git@github.com/tw.weekly/tw.weekly.c90.git</developerConnection>
     <tag>HEAD</tag>
   </scm>
   <dependencies>
@@ -30,16 +30,6 @@
       <artifactId>clojure</artifactId>
       <version>1.10.1</version>
     </dependency>
-    <dependency>
-      <groupId>net.mikera</groupId>
-      <artifactId>core.matrix</artifactId>
-      <version>0.62.0</version>
-    </dependency>
-    <dependency>
-      <groupId>org.clojure</groupId>
-      <artifactId>math.numeric-tower</artifactId>
-      <version>0.0.4</version>
-    </dependency>
   </dependencies>
   <build>
     <sourceDirectory>src</sourceDirectory>
diff --git a/challenge-090/tyler-wardhaugh/lua/README.md b/challenge-090/tyler-wardhaugh/lua/README.md
index d2f91b15fe..8772dac9c1 100644
--- a/challenge-090/tyler-wardhaugh/lua/README.md
+++ b/challenge-090/tyler-wardhaugh/lua/README.md
@@ -1,17 +1,17 @@
 
 # The Weekly Challenge
 
-The Weekly Challenge - #089 - Tyler Wardhaugh
+The Weekly Challenge - #090 - Tyler Wardhaugh
 
 ## Usage
 
 Run Task 1:
 
-    $ ./run.lua ch-1 N
+    $ ./run.lua ch-1 DNA
 
 Run Task 2:
 
-    $ ./run.lua ch-2 MATRIX-FILE
+    $ ./run.lua ch-2 A B
 
 Run the project's tests (all the samples from the task descriptions plus some others):
 
-- 
cgit 


From d6eeb2228b999315263e96d4b00bdf6f8d7c090e Mon Sep 17 00:00:00 2001
From: Aaron Smith <asmith@sumologic.com>
Date: Mon, 7 Dec 2020 14:26:21 -0600
Subject: Challenge 90 Raku solutions

---
 challenge-090/aaronreidsmith/raku/ch-1.raku | 14 ++++++++++++++
 challenge-090/aaronreidsmith/raku/ch-2.raku | 21 +++++++++++++++++++++
 2 files changed, 35 insertions(+)
 create mode 100644 challenge-090/aaronreidsmith/raku/ch-1.raku
 create mode 100644 challenge-090/aaronreidsmith/raku/ch-2.raku

(limited to 'challenge-090')

diff --git a/challenge-090/aaronreidsmith/raku/ch-1.raku b/challenge-090/aaronreidsmith/raku/ch-1.raku
new file mode 100644
index 0000000000..96adad1541
--- /dev/null
+++ b/challenge-090/aaronreidsmith/raku/ch-1.raku
@@ -0,0 +1,14 @@
+#!/usr/bin/env perl6
+
+subset ValidDna of Str where { $_ ~~ /^^[A|T|G|C]+$$/ }
+
+# Since DNA is generally read from 5' to 3', I included the option to find the
+# reverse compliment in addition to the complement
+sub MAIN($dna where $dna ~~ ValidDna, Bool :rc(:$reverse-complement) = False) {
+    my $translated = $dna.trans('ATGC' => 'TACG');
+    if $reverse-complement {
+        say "5'-{$translated.reverse}-3'";
+    } else {
+        say "3'-$translated-5'"
+    }
+}
diff --git a/challenge-090/aaronreidsmith/raku/ch-2.raku b/challenge-090/aaronreidsmith/raku/ch-2.raku
new file mode 100644
index 0000000000..cc85350dc6
--- /dev/null
+++ b/challenge-090/aaronreidsmith/raku/ch-2.raku
@@ -0,0 +1,21 @@
+#!/usr/bin/env perl6
+
+subset PositiveInt of Int where { $_ ~~ Int && $_ > 0 }
+
+sub generate-pairs($a, $b) {
+    sprintf("%02d, %02d", $a, $b).put;
+    if $a == 1 {
+        (($a, $b),);
+    } else {
+        (($a, $b), |generate-pairs($a div 2, $b * 2));
+    }
+}
+
+sub MAIN(PositiveInt $A, PositiveInt $B) {
+    say "Input: A: $A, B: $B";
+    say "Divide A by 2 (ignoring remainders) until it is 1. Multiply B by 2 as we go:";
+    my @pairs = generate-pairs($A, $B);
+    say "Then, wherever A is odd, we add the Bs together:";
+    my @odd-bs = @pairs.grep(-> @pair { !(@pair[0] %% 2) }).map(-> @pair { @pair[1] });
+    say "{@odd-bs.join(' + ')} = {@odd-bs.sum}";
+}
-- 
cgit 


From f3bc094d3c6a7cfafdcdcb64298cb078a90e6d66 Mon Sep 17 00:00:00 2001
From: Aaron Smith <asmith@sumologic.com>
Date: Mon, 7 Dec 2020 14:53:35 -0600
Subject: reverse -> flip

---
 challenge-090/aaronreidsmith/raku/ch-1.raku | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

(limited to 'challenge-090')

diff --git a/challenge-090/aaronreidsmith/raku/ch-1.raku b/challenge-090/aaronreidsmith/raku/ch-1.raku
index 96adad1541..b0c53e239a 100644
--- a/challenge-090/aaronreidsmith/raku/ch-1.raku
+++ b/challenge-090/aaronreidsmith/raku/ch-1.raku
@@ -7,7 +7,7 @@ subset ValidDna of Str where { $_ ~~ /^^[A|T|G|C]+$$/ }
 sub MAIN($dna where $dna ~~ ValidDna, Bool :rc(:$reverse-complement) = False) {
     my $translated = $dna.trans('ATGC' => 'TACG');
     if $reverse-complement {
-        say "5'-{$translated.reverse}-3'";
+        say "5'-{$translated.flip}-3'";
     } else {
         say "3'-$translated-5'"
     }
-- 
cgit 


From 0876e01a876b7e4a1cc523d2af1524663106f22f Mon Sep 17 00:00:00 2001
From: Aaron Smith <asmith@sumologic.com>
Date: Mon, 7 Dec 2020 15:18:07 -0600
Subject: Format output

---
 challenge-090/aaronreidsmith/raku/ch-2.raku | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

(limited to 'challenge-090')

diff --git a/challenge-090/aaronreidsmith/raku/ch-2.raku b/challenge-090/aaronreidsmith/raku/ch-2.raku
index cc85350dc6..fa5fe375c6 100644
--- a/challenge-090/aaronreidsmith/raku/ch-2.raku
+++ b/challenge-090/aaronreidsmith/raku/ch-2.raku
@@ -12,7 +12,7 @@ sub generate-pairs($a, $b) {
 }
 
 sub MAIN(PositiveInt $A, PositiveInt $B) {
-    say "Input: A: $A, B: $B";
+    say "Input: A=$A, B=$B";
     say "Divide A by 2 (ignoring remainders) until it is 1. Multiply B by 2 as we go:";
     my @pairs = generate-pairs($A, $B);
     say "Then, wherever A is odd, we add the Bs together:";
-- 
cgit 


From 42e642d8c70a32352d990d8490a46fe10c0c9b86 Mon Sep 17 00:00:00 2001
From: Aaron Smith <asmith@sumologic.com>
Date: Mon, 7 Dec 2020 15:43:03 -0600
Subject: Add input stats

---
 challenge-090/aaronreidsmith/raku/ch-1.raku | 3 +++
 1 file changed, 3 insertions(+)

(limited to 'challenge-090')

diff --git a/challenge-090/aaronreidsmith/raku/ch-1.raku b/challenge-090/aaronreidsmith/raku/ch-1.raku
index b0c53e239a..3c12a719c9 100644
--- a/challenge-090/aaronreidsmith/raku/ch-1.raku
+++ b/challenge-090/aaronreidsmith/raku/ch-1.raku
@@ -5,6 +5,9 @@ subset ValidDna of Str where { $_ ~~ /^^[A|T|G|C]+$$/ }
 # Since DNA is generally read from 5' to 3', I included the option to find the
 # reverse compliment in addition to the complement
 sub MAIN($dna where $dna ~~ ValidDna, Bool :rc(:$reverse-complement) = False) {
+    say "Input stats:\n{$dna.comb.Bag.Hash}\n";
+
+    say "Complement:";
     my $translated = $dna.trans('ATGC' => 'TACG');
     if $reverse-complement {
         say "5'-{$translated.flip}-3'";
-- 
cgit 


From 38277932edb4d62b034b9bc189fafc6fb432f1c4 Mon Sep 17 00:00:00 2001
From: Aaron Smith <asmith@sumologic.com>
Date: Mon, 7 Dec 2020 16:50:03 -0600
Subject: Add blog link

---
 challenge-090/aaronreidsmith/blog.txt | 1 +
 1 file changed, 1 insertion(+)
 create mode 100644 challenge-090/aaronreidsmith/blog.txt

(limited to 'challenge-090')

diff --git a/challenge-090/aaronreidsmith/blog.txt b/challenge-090/aaronreidsmith/blog.txt
new file mode 100644
index 0000000000..c0bf9276a7
--- /dev/null
+++ b/challenge-090/aaronreidsmith/blog.txt
@@ -0,0 +1 @@
+https://aaronreidsmith.github.io/blog/perl-weekly-challenge-090/
\ No newline at end of file
-- 
cgit 


From 4e09c2a1bcfc3828ec9855f7f9a3fa15529118ba Mon Sep 17 00:00:00 2001
From: Dave Jacoby <jacoby.david@gmail.com>
Date: Mon, 7 Dec 2020 22:45:47 -0500
Subject: Challenge 90 in Perl

---
 challenge-090/dave-jacoby/perl/ch-1.pl | 22 ++++++++++++++++++++
 challenge-090/dave-jacoby/perl/ch-2.pl | 38 ++++++++++++++++++++++++++++++++++
 2 files changed, 60 insertions(+)
 create mode 100644 challenge-090/dave-jacoby/perl/ch-1.pl
 create mode 100644 challenge-090/dave-jacoby/perl/ch-2.pl

(limited to 'challenge-090')

diff --git a/challenge-090/dave-jacoby/perl/ch-1.pl b/challenge-090/dave-jacoby/perl/ch-1.pl
new file mode 100644
index 0000000000..ed5f5e8cc6
--- /dev/null
+++ b/challenge-090/dave-jacoby/perl/ch-1.pl
@@ -0,0 +1,22 @@
+#!/usr/bin/env perl
+
+use strict;
+use warnings;
+use feature qw{ say signatures state };
+no warnings qw{ experimental };
+
+my $sequence =  'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG' ;
+my $complement = $sequence;
+$complement =~ tr/TACG/ATGC/;
+
+say <<"END";
+    Sequence:   $sequence
+    Complement: $complement
+END
+
+for my $i ( qw( A T C G ) ) {
+    my $n = scalar grep {/$i/} split // , $sequence;
+    say qq(    $i: $n );
+}
+
+
diff --git a/challenge-090/dave-jacoby/perl/ch-2.pl b/challenge-090/dave-jacoby/perl/ch-2.pl
new file mode 100644
index 0000000000..2973f52f1d
--- /dev/null
+++ b/challenge-090/dave-jacoby/perl/ch-2.pl
@@ -0,0 +1,38 @@
+#!/usr/bin/env perl
+
+use strict;
+use warnings;
+use feature qw{ say signatures state };
+no warnings qw{ experimental };
+
+use Scalar::Util qw{looks_like_number};
+
+my ( $m, $n ) = map { abs $_ } grep { looks_like_number $_ } @ARGV;
+
+$m //= 17;
+$n //= 38;
+
+say <<"END";
+
+    m $m
+    n $n
+END
+
+say egyptian( $m, $n );
+say $m * $n;
+
+exit;
+
+sub egyptian ( $m, $n ) {
+    my $o = 0;
+    my $i = 1;
+    do {
+        my $e = $m % 2 != 0 ? 1 : 0;
+        say join "\t", $o, $e, $i, $m, $n;
+        $o += $n if $e;
+        $i *= 2;
+        $m = int $m / 2;
+        $n = $n * 2;
+    } while ( $m > 0 );
+    return $o;
+}
-- 
cgit 


From 52e0077613ff011285f9e381f774bb9ce56be99a Mon Sep 17 00:00:00 2001
From: Dave Jacoby <jacoby.david@gmail.com>
Date: Mon, 7 Dec 2020 23:42:33 -0500
Subject: Blogged It!

---
 challenge-090/dave-jacoby/blog.txt | 1 +
 1 file changed, 1 insertion(+)
 create mode 100644 challenge-090/dave-jacoby/blog.txt

(limited to 'challenge-090')

diff --git a/challenge-090/dave-jacoby/blog.txt b/challenge-090/dave-jacoby/blog.txt
new file mode 100644
index 0000000000..b692db20a0
--- /dev/null
+++ b/challenge-090/dave-jacoby/blog.txt
@@ -0,0 +1 @@
+https://jacoby.github.io/2020/12/08/multiplication-and-dna-perl-weekly-challenge-90.html
\ No newline at end of file
-- 
cgit 


From b687fe1babaa737f2d4d409338262c2f9ad1618c Mon Sep 17 00:00:00 2001
From: Alexander Pankoff <ccntrq@screenri.de>
Date: Tue, 8 Dec 2020 13:39:52 +0100
Subject: add solutions for challenge-090 in perl

---
 challenge-090/alexander-pankoff/perl/ch-1.pl | 17 ++++++++++++++
 challenge-090/alexander-pankoff/perl/ch-2.pl | 34 ++++++++++++++++++++++++++++
 2 files changed, 51 insertions(+)
 create mode 100755 challenge-090/alexander-pankoff/perl/ch-1.pl
 create mode 100755 challenge-090/alexander-pankoff/perl/ch-2.pl

(limited to 'challenge-090')

diff --git a/challenge-090/alexander-pankoff/perl/ch-1.pl b/challenge-090/alexander-pankoff/perl/ch-1.pl
new file mode 100755
index 0000000000..15f2c016bc
--- /dev/null
+++ b/challenge-090/alexander-pankoff/perl/ch-1.pl
@@ -0,0 +1,17 @@
+#!/usr/bin/env perl
+use v5.20;
+use utf8;
+use strict;
+use warnings;
+use feature qw(say signatures);
+no warnings 'experimental::signatures';
+
+{
+    my ( $sequence ) = @ARGV;
+    die 'need dna sequence' unless $sequence;
+    my %complements = ( T => 'A', G => 'C' );
+    %complements = ( %complements, reverse %complements );
+
+    say 'Nucleiobase count: ' . length( $sequence );
+    say 'Complementary sequence: ' . join( '', map { $complements{$_} } split( '', $sequence ) );
+}
diff --git a/challenge-090/alexander-pankoff/perl/ch-2.pl b/challenge-090/alexander-pankoff/perl/ch-2.pl
new file mode 100755
index 0000000000..51f636cc6f
--- /dev/null
+++ b/challenge-090/alexander-pankoff/perl/ch-2.pl
@@ -0,0 +1,34 @@
+#!/usr/bin/env perl
+use v5.20;
+use utf8;
+use strict;
+use warnings;
+use feature qw(say signatures);
+no warnings 'experimental::signatures';
+
+use List::Util qw(sum0);
+
+use Test::Simple tests => 20;
+
+{
+    for ( 0 .. 19 ) {
+        my ( $a, $b ) = map { int( rand( 1000 ) ) + 1 } 0 .. 1;
+        my $expected = $a * $b;
+        ok( ethopian_mul( $a, $b ) == $expected, "ethopian_mul($a, $b) = $a * $b = $expected" );
+    }
+}
+
+sub ethopian_mul ( $a, $b ) {
+    return sum0( map { $_->[1] } grep { odd( $_->[0] ) } ethopian_mul_chain( $a, $b ) );
+}
+
+sub ethopian_mul_chain ( $a, $b ) {
+    return [ $a, $b ] if $a <= 1;
+
+    # using bit shifts to avoid use of multiplication
+    return ( [ $a, $b ], ethopian_mul_chain( $a >> 1, $b << 1 ) );
+}
+
+sub odd($x) {
+    $x != ( ( $x >> 1 ) << 1 );
+}
-- 
cgit 


From 958a003d916036a4f72aa87fa5a3d5ea2717d952 Mon Sep 17 00:00:00 2001
From: Alexander Pankoff <ccntrq@screenri.de>
Date: Tue, 8 Dec 2020 14:10:52 +0100
Subject: reimplement odd

---
 challenge-090/alexander-pankoff/perl/ch-2.pl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

(limited to 'challenge-090')

diff --git a/challenge-090/alexander-pankoff/perl/ch-2.pl b/challenge-090/alexander-pankoff/perl/ch-2.pl
index 51f636cc6f..eb588779f8 100755
--- a/challenge-090/alexander-pankoff/perl/ch-2.pl
+++ b/challenge-090/alexander-pankoff/perl/ch-2.pl
@@ -30,5 +30,5 @@ sub ethopian_mul_chain ( $a, $b ) {
 }
 
 sub odd($x) {
-    $x != ( ( $x >> 1 ) << 1 );
+    $x & 1;
 }
-- 
cgit 


From 92d41f92a59d5ebad74d12edec19e86ad1d53aed Mon Sep 17 00:00:00 2001
From: Alexander Pankoff <ccntrq@screenri.de>
Date: Tue, 8 Dec 2020 14:11:00 +0100
Subject: add verbose mode

---
 challenge-090/alexander-pankoff/perl/ch-2.pl | 13 ++++++++++++-
 1 file changed, 12 insertions(+), 1 deletion(-)

(limited to 'challenge-090')

diff --git a/challenge-090/alexander-pankoff/perl/ch-2.pl b/challenge-090/alexander-pankoff/perl/ch-2.pl
index eb588779f8..a66c4feea7 100755
--- a/challenge-090/alexander-pankoff/perl/ch-2.pl
+++ b/challenge-090/alexander-pankoff/perl/ch-2.pl
@@ -10,6 +10,8 @@ use List::Util qw(sum0);
 
 use Test::Simple tests => 20;
 
+use constant VERBOSE => $ENV{VERBOSE} // 0;
+
 {
     for ( 0 .. 19 ) {
         my ( $a, $b ) = map { int( rand( 1000 ) ) + 1 } 0 .. 1;
@@ -19,7 +21,16 @@ use Test::Simple tests => 20;
 }
 
 sub ethopian_mul ( $a, $b ) {
-    return sum0( map { $_->[1] } grep { odd( $_->[0] ) } ethopian_mul_chain( $a, $b ) );
+    my @chain = ethopian_mul_chain( $a, $b );
+    verbose( "halving $a, doubling $b, till $a becomes 1" );
+    verbose( $_->[0] . ' & ' . $_->[1] ) for @chain;
+
+    my @filtered = map { $_->[1] } grep { odd( $_->[0] ) } @chain;
+    verbose( "taking right values where left value is odd" );
+    verbose( $_ ) for @filtered;
+    my $product = sum0( @filtered );
+    verbose( "product is $product" );
+    return $product;
 }
 
 sub ethopian_mul_chain ( $a, $b ) {
-- 
cgit 


From e14c1c849dc1988a9c93e08413c86c5105753fcd Mon Sep 17 00:00:00 2001
From: Cris-HD <crisn7@hotmail.com>
Date: Tue, 8 Dec 2020 15:22:52 +0100
Subject: Added challenge 90 solution

---
 challenge-090/cristian-heredia/perl/ch-2.pl | 38 +++++++++++++++++++++++++++++
 1 file changed, 38 insertions(+)
 create mode 100644 challenge-090/cristian-heredia/perl/ch-2.pl

(limited to 'challenge-090')

diff --git a/challenge-090/cristian-heredia/perl/ch-2.pl b/challenge-090/cristian-heredia/perl/ch-2.pl
new file mode 100644
index 0000000000..2aeac8b209
--- /dev/null
+++ b/challenge-090/cristian-heredia/perl/ch-2.pl
@@ -0,0 +1,38 @@
+=begin
+
+    TASK #2 › Ethiopian Multiplication
+    Submitted by: Mohammad S Anwar
+    You are given two positive numbers $A and $B.
+    
+    Write a script to demonstrate Ethiopian Multiplication using the given numbers.
+
+=end
+=cut
+
+use strict;
+use warnings;
+
+#variables:
+my $A = 14;
+my $B = 12;
+my $result = 0;
+print "The result for $A * $B is: ";
+calculation();
+
+sub calculation {
+    checkOdd($A);
+    while ($A != 1) {
+        use integer;
+        $A = $A/2;
+        $B = $B*2;
+        checkOdd($A);
+    }
+    print "$result\n";
+}
+
+sub checkOdd {
+    my $number = shift;
+    if ($number%2) {
+        $result = $result + $B;
+    }
+}
\ No newline at end of file
-- 
cgit 


From a1e3221c5747a2960ce1b9045333c309434c431c Mon Sep 17 00:00:00 2001
From: Andinus <andinus@nand.sh>
Date: Tue, 8 Dec 2020 22:33:57 +0530
Subject: Add challenge-090 task 2 solution

---
 challenge-090/andinus/README         | 94 +++++++++++++++++++++++-------------
 challenge-090/andinus/README.org     | 75 ++++++++++++++++++++++++++++
 challenge-090/andinus/blog-2.txt     |  1 +
 challenge-090/andinus/raku/ch-2.raku | 38 +++++++++++++++
 4 files changed, 175 insertions(+), 33 deletions(-)
 create mode 100644 challenge-090/andinus/README.org
 create mode 100644 challenge-090/andinus/blog-2.txt
 create mode 100755 challenge-090/andinus/raku/ch-2.raku

(limited to 'challenge-090')

diff --git a/challenge-090/andinus/README b/challenge-090/andinus/README
index b372bec8d3..b662f1cb50 100644
--- a/challenge-090/andinus/README
+++ b/challenge-090/andinus/README
@@ -1,67 +1,95 @@
                             ━━━━━━━━━━━━━━━
-                             CHALLENGE 086
+                             CHALLENGE 090
 
                                 Andinus
                             ━━━━━━━━━━━━━━━
 
 
-                               2020-11-15
+                               2020-12-08
 
 
 Table of Contents
 ─────────────────
 
-1. Task 1 - Pair Difference
-.. 1. Perl
+1. Task 2 - Ethiopian Multiplication
+.. 1. Raku
 
 
 
 
 
-1 Task 1 - Pair Difference
-══════════════════════════
+1 Task 2 - Ethiopian Multiplication
+═══════════════════════════════════
 
-  You are given an array of integers @N and an integer $A.
+  You are given two positive numbers $A and $B.
 
-  Write a script to find find if there exists a pair of elements in the
-  array whose difference is $A.
+  Write a script to demonstrate [Ethiopian Multiplication] using the
+  given numbers.
 
-  Print 1 if exists otherwise 0.
 
+[Ethiopian Multiplication]
+<https://threesixty360.wordpress.com/2009/06/09/ethiopian-multiplication/>
 
-1.1 Perl
+1.1 Raku
 ────────
 
-  • Program: <file:perl/ch-1.pl>
+  • Program: <file:perl/ch-2.raku>
 
-  @N & $A are taken from stdin, $A is the last argument.
+  Start by taking `$A' & `$B' which are defined to be `Int' & positive.
   ┌────
-  │ die "usage: ./ch-1.pl <integers \@N> <integer \$A>\n"
-  │     unless scalar @ARGV >= 3;
-  │
-  │ my $A = pop @ARGV;
-  │ my @N = @ARGV;
+  │ sub MAIN (
+  │     #= positive numbers
+  │     Int $A is copy where * > 0,
+  │     Int $B is copy where * > 0
+  │ ) {
+  │     ...
+  │ }
   └────
 
-  We just loop over @N over a loop over @N & find the difference. If
-  it's equal to `$A' or `-$A' then we print `1' & exit. The first loop
-  is `shift''ing the numbers out of array `@N' because we are matching
-  for both `$A' & `-$A' so we don't need the number again.
+  Here's relevant part from the link that was given above:
+        Start with the two numbers on top. Halve one, ignoring any
+        remainders or fractions, and double the other, stopping
+        when you get to 1.
 
-  For example, if `@N = [1, 2]' & we don't `shift' in first loop then
-  we'll perform 2 subtraction operations: `1 - 2' & `2 - 1' & we won't
-  have to match for `-$A' but if we just match for `-$A' then we can use
-  `shift' & we'll only have to perform 1 subtraction operation `1 - 2'.
+        14 & 12 7 & 24 3 & 48 [See how I ignored the fact that
+        halving 7 leaves 1 left over?] 1 & 96 <— Stop here.
 
-  We assume subtraction costs more than matching with `-$A', that makes
-  this more efficient. But it doesn't matter much.
+        Now look at the numbers on the right. Some are across from
+        an even number: in this case, 12 is across from the
+        original 14. Ignore those, and add the rest. So we’ll add
+        24, 48, and 96, which were across from odd numbers, and
+        get 168. And that’s the product! Isn’t that cool?
+
+  We do the same thing & also print the instructions.
   ┌────
-  │ while (my $int = shift @N) {
-  │     foreach (@N) {
-  │         my $diff = $int - $_;
-  │         print "1\n" and exit 0 if ($diff == $A or $diff == -$A);
+  │ my %sets;
+  │
+  │ say "Ethopian Multiplication.\n";
+  │ say "Start with $A, $B.";
+  │ say "Divide $A by 2 & multiple $B by 2 at each step.";
+  │ say "Continue until $A equals 1. Drop the remainder, both should be Integer.\n";
+  │
+  │ say "$A, $B";
+  │ while True {
+  │     %sets{$A} = $B.Int;
+  │     $A = ($A / 2).Int;
+  │     $B = ($B * 2).Int;
+  │     last if $A < 1;
+  │     say "$A, $B";
+  │ }
+  │
+  │ say "\nNow to find the product, simply add all the numbers on right side of ','.";
+  │ say "But skip those numbers which have an even number on the left side.\n";
+  │
+  │ my Int $product = 0;
+  │ for %sets.sort({.key.Int}).reverse -> $pair {
+  │     if $pair.key % 2 != 0 {
+  │         $product += $pair.value;
+  │         say "- Adding ", $pair.value, " to product.";
+  │     } else {
+  │         say "- Skipping ", $pair.value, " because ", $pair.key, " is even.";
   │     }
   │ }
-  │ print "0\n";
   │
+  │ say "\nProduct: $product";
   └────
diff --git a/challenge-090/andinus/README.org b/challenge-090/andinus/README.org
new file mode 100644
index 0000000000..c4f5da3378
--- /dev/null
+++ b/challenge-090/andinus/README.org
@@ -0,0 +1,75 @@
+#+SETUPFILE: ~/.emacs.d/org-templates/level-2.org
+#+HTML_LINK_UP: ../index.html
+#+OPTIONS: toc:2
+#+EXPORT_FILE_NAME: index
+#+DATE: 2020-12-08
+#+TITLE: Challenge 090
+
+* Task 2 - Ethiopian Multiplication
+You are given two positive numbers $A and $B.
+
+Write a script to demonstrate [[https://threesixty360.wordpress.com/2009/06/09/ethiopian-multiplication/][Ethiopian Multiplication]] using the given
+numbers.
+** Raku
+- Program: [[file:perl/ch-2.raku]]
+
+Start by taking =$A= & =$B= which are defined to be =Int= & positive.
+#+BEGIN_SRC raku
+sub MAIN (
+    #= positive numbers
+    Int $A is copy where * > 0,
+    Int $B is copy where * > 0
+) {
+    ...
+}
+#+END_SRC
+
+Here's relevant part from the link that was given above:
+#+BEGIN_QUOTE
+Start with the two numbers on top. Halve one, ignoring any remainders or
+fractions, and double the other, stopping when you get to 1.
+
+14 & 12
+7 & 24
+3 & 48  [See how I ignored the fact that halving 7 leaves 1 left over?]
+1 & 96  <— Stop here.
+
+Now look at the numbers on the right. Some are across from an even
+number: in this case, 12 is across from the original 14. Ignore those,
+and add the rest. So we’ll add 24, 48, and 96, which were across from
+odd numbers, and get 168. And that’s the product! Isn’t that cool?
+#+END_QUOTE
+
+We do the same thing & also print the instructions.
+#+BEGIN_SRC raku
+my %sets;
+
+say "Ethopian Multiplication.\n";
+say "Start with $A, $B.";
+say "Divide $A by 2 & multiple $B by 2 at each step.";
+say "Continue until $A equals 1. Drop the remainder, both should be Integer.\n";
+
+say "$A, $B";
+while True {
+    %sets{$A} = $B.Int;
+    $A = ($A / 2).Int;
+    $B = ($B * 2).Int;
+    last if $A < 1;
+    say "$A, $B";
+}
+
+say "\nNow to find the product, simply add all the numbers on right side of ','.";
+say "But skip those numbers which have an even number on the left side.\n";
+
+my Int $product = 0;
+for %sets.sort({.key.Int}).reverse -> $pair {
+    if $pair.key % 2 != 0 {
+        $product += $pair.value;
+        say "- Adding ", $pair.value, " to product.";
+    } else {
+        say "- Skipping ", $pair.value, " because ", $pair.key, " is even.";
+    }
+}
+
+say "\nProduct: $product";
+#+END_SRC
diff --git a/challenge-090/andinus/blog-2.txt b/challenge-090/andinus/blog-2.txt
new file mode 100644
index 0000000000..5b667faed0
--- /dev/null
+++ b/challenge-090/andinus/blog-2.txt
@@ -0,0 +1 @@
+https://andinus.tilde.institute/pwc/challenge-090/
diff --git a/challenge-090/andinus/raku/ch-2.raku b/challenge-090/andinus/raku/ch-2.raku
new file mode 100755
index 0000000000..5a30ae90b4
--- /dev/null
+++ b/challenge-090/andinus/raku/ch-2.raku
@@ -0,0 +1,38 @@
+#!/usr/bin/env raku
+
+sub MAIN (
+    #= positive numbers
+    Int $A is copy where * > 0,
+    Int $B is copy where * > 0
+) {
+    my %sets;
+
+    say "Ethopian Multiplication.\n";
+    say "Start with $A, $B.";
+    say "Divide $A by 2 & multiple $B by 2 at each step.";
+    say "Continue until $A equals 1. Drop the remainder, both should be Integer.\n";
+
+    say "$A, $B";
+    while True {
+        %sets{$A} = $B.Int;
+        $A = ($A / 2).Int;
+        $B = ($B * 2).Int;
+        last if $A < 1;
+        say "$A, $B";
+    }
+
+    say "\nNow to find the product, simply add all the numbers on right side of ','.";
+    say "But skip those numbers which have an even number on the left side.\n";
+
+    my Int $product = 0;
+    for %sets.sort({.key.Int}).reverse -> $pair {
+        if $pair.key % 2 != 0 {
+            $product += $pair.value;
+            say "- Adding ", $pair.value, " to product.";
+        } else {
+            say "- Skipping ", $pair.value, " because ", $pair.key, " is even.";
+        }
+    }
+
+    say "\nProduct: $product";
+}
-- 
cgit 


From fa883cb3f3225a37216f0ff9c6eaf1cc5426b827 Mon Sep 17 00:00:00 2001
From: ziameraj16 <ziameraj16@gmail.com>
Date: Tue, 8 Dec 2020 18:08:50 +0000
Subject: Java Solution for Ethiopian Multiplication

---
 challenge-090/ziameraj16/README.md                 |  1 +
 .../ziameraj16/java/EthiopianMultiplication.java   | 25 ++++++++++++++++++++++
 2 files changed, 26 insertions(+)
 create mode 100644 challenge-090/ziameraj16/README.md
 create mode 100755 challenge-090/ziameraj16/java/EthiopianMultiplication.java

(limited to 'challenge-090')

diff --git a/challenge-090/ziameraj16/README.md b/challenge-090/ziameraj16/README.md
new file mode 100644
index 0000000000..e04a1c63a3
--- /dev/null
+++ b/challenge-090/ziameraj16/README.md
@@ -0,0 +1 @@
+Solution by Mohammad Meraj Zia
diff --git a/challenge-090/ziameraj16/java/EthiopianMultiplication.java b/challenge-090/ziameraj16/java/EthiopianMultiplication.java
new file mode 100755
index 0000000000..da39b823e5
--- /dev/null
+++ b/challenge-090/ziameraj16/java/EthiopianMultiplication.java
@@ -0,0 +1,25 @@
+
+import java.util.Scanner;
+
+public class EthiopianMultiplication {
+
+    public static void main(String[] args) {
+        Scanner scanner = new Scanner(System.in);
+        System.out.println("Enter first number");
+        final int first = scanner.nextInt();
+        System.out.println("Enter second number");
+        final int second = scanner.nextInt();
+        System.out.println("Result using Ethiopian Multiplication: " + multiply(first, second));
+    }
+
+    public static int multiply(int first, int second) {
+        int sum = 0;
+        for (int i = first; i >= 1; i = i/2) {
+            if (i % 2 != 0) {
+                sum += second;
+            }
+            second = second * 2;
+        }
+        return sum;
+    }
+}
-- 
cgit 


From 085764e526d26c50a09a2c0c18da809268e32f33 Mon Sep 17 00:00:00 2001
From: Tyler Wardhaugh <tyler.wardhaugh@gmail.com>
Date: Mon, 7 Dec 2020 12:39:22 -0800
Subject: Ch90 (Clojure): Task 1 & Task 2

---
 .../clojure/src/tw/weekly/c90/core.clj             | 12 ++++++++++
 .../clojure/src/tw/weekly/c90/t1.clj               | 28 ++++++++++++++++++++++
 .../clojure/src/tw/weekly/c90/t2.clj               | 22 +++++++++++++++++
 .../clojure/test/tw/weekly/c90_test.clj            | 16 +++++++++++++
 4 files changed, 78 insertions(+)
 create mode 100644 challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/core.clj
 create mode 100644 challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t1.clj
 create mode 100644 challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t2.clj
 create mode 100644 challenge-090/tyler-wardhaugh/clojure/test/tw/weekly/c90_test.clj

(limited to 'challenge-090')

diff --git a/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/core.clj b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/core.clj
new file mode 100644
index 0000000000..296c2c6051
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/core.clj
@@ -0,0 +1,12 @@
+(ns tw.weekly.c90.core
+  (:require [tw.weekly.c90.t1 :as t1])
+  (:require [tw.weekly.c90.t2 :as t2])
+  (:gen-class))
+
+(defn -main
+  "Run all tasks"
+  [& _]
+  (println "Task #1:")
+  (t1/-main)
+  (println "\nTask #2:")
+  (t2/-main))
diff --git a/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t1.clj b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t1.clj
new file mode 100644
index 0000000000..e739241345
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t1.clj
@@ -0,0 +1,28 @@
+(ns tw.weekly.c90.t1
+  (:require [clojure.string :as str])
+  (:require [clojure.pprint :refer [cl-format]])
+  (:require [clojure.edn :as edn]))
+
+;;;
+; Task description for TASK #1 › DNA Sequence
+;;;
+
+(def DEFAULT-DNA
+  "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG")
+
+(defn process-dna
+  "Process the DNA sequence, counting nucleiobases and determining the
+  complementary sequence."
+  [dna]
+  (let [complement-dna (fn [s] (str/escape s {\T \A, \A \T, \C \G, \G \C}))]
+    ((juxt frequencies complement-dna) dna)))
+
+(defn -main
+  "Run Task 1 with a given DNA sequence, defaulting to the example given in
+  the task description."
+  [& args]
+  (let [dna (or (some-> args first edn/read-string) DEFAULT-DNA)
+        [freqs complement-seq] (process-dna dna)]
+    (cl-format true "~12a: ~a~%~12a: ~a~%"
+               "Counts" freqs
+               "Complement" complement-seq)))
diff --git a/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t2.clj b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t2.clj
new file mode 100644
index 0000000000..ab767f91fc
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t2.clj
@@ -0,0 +1,22 @@
+(ns tw.weekly.c90.t2
+  (:require [clojure.edn :as edn]))
+
+;;;
+; Task description for TASK #2 › Ethiopian Multiplication
+;;;
+
+(defn ethiopian-multiply
+  "Compute the product of two positive integers using Ethiopian Multiplication."
+  [a b]
+  (let [source (map vector (iterate #(quot % 2) a) (iterate #(* 2 %) b))
+        xf (comp
+             (take-while (fn [[a _]] (pos? a)))
+             (keep (fn [[a b]] (when (odd? a) b))))]
+    (transduce xf + source)))
+
+(defn -main
+  "Run Task 2 with the given positive integers, defaulting to the example
+  given in the explanation page linked from the task description."
+  [& args]
+  (let [[A B] (or (some->> args (take 2) (map edn/read-string)) [12 14])]
+    (println (ethiopian-multiply A B))))
diff --git a/challenge-090/tyler-wardhaugh/clojure/test/tw/weekly/c90_test.clj b/challenge-090/tyler-wardhaugh/clojure/test/tw/weekly/c90_test.clj
new file mode 100644
index 0000000000..a09788f137
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/test/tw/weekly/c90_test.clj
@@ -0,0 +1,16 @@
+(ns tw.weekly.c90-test
+  (:require [clojure.test :refer [deftest is testing]]
+            [tw.weekly.c90.t1 :refer [DEFAULT-DNA process-dna]]
+            [tw.weekly.c90.t2 :refer [ethiopian-multiply]]))
+
+(def COMPLEMENT-DEFAULT-DNA
+  "CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC")
+
+(deftest task-1
+  (testing "Task 1, DNA Sequence"
+    (is (= [{\G 13, \T 22, \A 14, \C 18}, COMPLEMENT-DEFAULT-DNA]
+           (process-dna DEFAULT-DNA)))))
+
+(deftest task-2
+  (testing "Task 2, Ethiopian Multiplication"
+    (is (= 168 (ethiopian-multiply 12 14)))))
-- 
cgit 


From ec53034d57fe6d3a652c29ad0f6b6ba33d8ed848 Mon Sep 17 00:00:00 2001
From: Tyler Wardhaugh <tyler.wardhaugh@gmail.com>
Date: Tue, 8 Dec 2020 13:07:11 -0800
Subject: Ch90 (Lua): Tasks 1 & 2

---
 challenge-090/tyler-wardhaugh/lua/ch-1.lua | 35 ++++++++++++++++++++++++++++++
 challenge-090/tyler-wardhaugh/lua/ch-2.lua | 27 +++++++++++++++++++++++
 challenge-090/tyler-wardhaugh/lua/run.lua  |  9 ++++++++
 challenge-090/tyler-wardhaugh/lua/test.lua | 21 ++++++++++++++++++
 challenge-090/tyler-wardhaugh/lua/util.lua | 14 ++++++++++++
 5 files changed, 106 insertions(+)
 create mode 100755 challenge-090/tyler-wardhaugh/lua/ch-1.lua
 create mode 100755 challenge-090/tyler-wardhaugh/lua/ch-2.lua
 create mode 100755 challenge-090/tyler-wardhaugh/lua/run.lua
 create mode 100755 challenge-090/tyler-wardhaugh/lua/test.lua
 create mode 100644 challenge-090/tyler-wardhaugh/lua/util.lua

(limited to 'challenge-090')

diff --git a/challenge-090/tyler-wardhaugh/lua/ch-1.lua b/challenge-090/tyler-wardhaugh/lua/ch-1.lua
new file mode 100755
index 0000000000..e964ce9f6d
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/ch-1.lua
@@ -0,0 +1,35 @@
+#!/usr/bin/env lua
+
+local t1 = {}
+local util = require'util'
+
+t1.DEFAULT_DNA = 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG'
+
+function t1.process_dna(dna)
+  freq = {}
+  for c in dna:gmatch'.' do
+    freq[c] = (freq[c] or 0) + 1
+  end
+
+  local replacement = {A='T', T='A', C='G', G='C'}
+  local complement = dna:gsub('(%w)', function (c) return replacement[c] end)
+
+  return freq, complement
+end
+
+function t1.run(args)
+  local dna = args[1] or t1.DEFAULT_DNA
+  local freq, complement = t1.process_dna(dna)
+
+  io.write('Counts = { ')
+  local seq = util.dict_to_seq(freq)
+  for i, v in ipairs(seq) do
+    io.write(v[1] .. ': ' .. v[2])
+    if i ~= #seq then io.write(', ') end
+  end
+  print(' }\n')
+
+  print('Complement: ' .. complement)
+end
+
+return t1
diff --git a/challenge-090/tyler-wardhaugh/lua/ch-2.lua b/challenge-090/tyler-wardhaugh/lua/ch-2.lua
new file mode 100755
index 0000000000..85c69b7be8
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/ch-2.lua
@@ -0,0 +1,27 @@
+#!/usr/bin/env lua
+
+local t2 = {}
+
+function t2.ethiopian_multiply(a, b)
+  local product = 0
+
+  while a > 0 do
+    if a % 2 ~= 0 then
+      product = product + b
+    end
+
+    a = a // 2
+    b = b * 2
+  end
+
+  return product
+end
+
+function t2.run(args)
+  local A = tonumber(args[1]) or 12
+  local B = tonumber(args[2]) or 14
+  local product = t2.ethiopian_multiply(A, B)
+  print(product)
+end
+
+return t2
diff --git a/challenge-090/tyler-wardhaugh/lua/run.lua b/challenge-090/tyler-wardhaugh/lua/run.lua
new file mode 100755
index 0000000000..c6e7473bee
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/run.lua
@@ -0,0 +1,9 @@
+#!/usr/bin/env lua
+
+local filename = arg[1]
+local run_args = table.move(arg, 2, #arg, 1, {})
+
+io.write(string.format("Running task from '%s' with {%s}:\n",
+  filename, table.concat(run_args, ", ")))
+
+require(filename).run(run_args)
diff --git a/challenge-090/tyler-wardhaugh/lua/test.lua b/challenge-090/tyler-wardhaugh/lua/test.lua
new file mode 100755
index 0000000000..7dffde2f53
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/test.lua
@@ -0,0 +1,21 @@
+#!/usr/bin/env lua
+
+require 'busted.runner'()
+
+describe("Task 1, DNA Sequence", function()
+  local t1 = require'ch-1'
+  it("produces correct results for the examples", function()
+    local freq, complement = t1.process_dna(t1.DEFAULT_DNA)
+    assert.are.same({G=13, T=22, A=14, C=18 }, freq)
+    assert.are.same('CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC',
+      complement)
+  end)
+end)
+
+describe("Task 2, Ethiopian Multiplication", function()
+  local t2 = require'ch-2'
+  it("produces correct results for the examples", function()
+    assert.are.same(168, t2.ethiopian_multiply(12, 14))
+    assert.are.same(1554, t2.ethiopian_multiply(37, 42))
+  end)
+end)
diff --git a/challenge-090/tyler-wardhaugh/lua/util.lua b/challenge-090/tyler-wardhaugh/lua/util.lua
new file mode 100644
index 0000000000..1623b04824
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/util.lua
@@ -0,0 +1,14 @@
+#!/usr/bin/env lua
+
+util = {}
+
+--[[ table ]]--
+function util.dict_to_seq(coll)
+  local result = {}
+  for k, v in pairs(coll) do
+    table.insert(result, { k, v })
+  end
+  return result
+end
+
+return util
-- 
cgit 


From b2142f9dbfe0bec3146ea3ef6bd76241438b167e Mon Sep 17 00:00:00 2001
From: Garrett Goebel <garrett.goebel@gmail.com>
Date: Tue, 8 Dec 2020 18:43:48 -0500
Subject: challenge-090 Raku

---
 challenge-090/garrett-goebel/README         | 1 +
 challenge-090/garrett-goebel/raku/ch-1.raku | 2 ++
 challenge-090/garrett-goebel/raku/ch-2.raku | 2 ++
 3 files changed, 5 insertions(+)
 create mode 100644 challenge-090/garrett-goebel/README
 create mode 100644 challenge-090/garrett-goebel/raku/ch-1.raku
 create mode 100644 challenge-090/garrett-goebel/raku/ch-2.raku

(limited to 'challenge-090')

diff --git a/challenge-090/garrett-goebel/README b/challenge-090/garrett-goebel/README
new file mode 100644
index 0000000000..a8aa246dbb
--- /dev/null
+++ b/challenge-090/garrett-goebel/README
@@ -0,0 +1 @@
+Solution by Garrett Goebel
diff --git a/challenge-090/garrett-goebel/raku/ch-1.raku b/challenge-090/garrett-goebel/raku/ch-1.raku
new file mode 100644
index 0000000000..7c034427ea
--- /dev/null
+++ b/challenge-090/garrett-goebel/raku/ch-1.raku
@@ -0,0 +1,2 @@
+#!/usr/bin/env raku
+'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG'.comb.elems.say;
diff --git a/challenge-090/garrett-goebel/raku/ch-2.raku b/challenge-090/garrett-goebel/raku/ch-2.raku
new file mode 100644
index 0000000000..b955dd9446
--- /dev/null
+++ b/challenge-090/garrett-goebel/raku/ch-2.raku
@@ -0,0 +1,2 @@
+#!/usr/bin/env raku
+say TR/TAGC/ATCG/ with 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
-- 
cgit 


From e37762846b7c44fdcafb9d58edf3a7b5f2246747 Mon Sep 17 00:00:00 2001
From: Garrett Goebel <garrett.goebel@gmail.com>
Date: Tue, 8 Dec 2020 18:53:48 -0500
Subject: challenge-090 Task 1 Raku

---
 challenge-090/garrett-goebel/raku/ch-1.raku | 5 ++++-
 1 file changed, 4 insertions(+), 1 deletion(-)

(limited to 'challenge-090')

diff --git a/challenge-090/garrett-goebel/raku/ch-1.raku b/challenge-090/garrett-goebel/raku/ch-1.raku
index 7c034427ea..00c9d0df57 100644
--- a/challenge-090/garrett-goebel/raku/ch-1.raku
+++ b/challenge-090/garrett-goebel/raku/ch-1.raku
@@ -1,2 +1,5 @@
 #!/usr/bin/env raku
-'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG'.comb.elems.say;
+'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG'.&{
+    say 'Nucleiobase count: ' ~ .comb.elems;
+    say 'Complementary sequence: ' ~ TR/TAGC/ATCG/;
+}
-- 
cgit 


From 07d9a1cb90b8268487449bc1a109a001787ce3f1 Mon Sep 17 00:00:00 2001
From: Garrett Goebel <garrett.goebel@gmail.com>
Date: Tue, 8 Dec 2020 19:33:20 -0500
Subject: challenge-090 Task 2 Raku

---
 challenge-090/garrett-goebel/raku/ch-2.raku | 17 ++++++++++++++++-
 1 file changed, 16 insertions(+), 1 deletion(-)

(limited to 'challenge-090')

diff --git a/challenge-090/garrett-goebel/raku/ch-2.raku b/challenge-090/garrett-goebel/raku/ch-2.raku
index b955dd9446..35324621de 100644
--- a/challenge-090/garrett-goebel/raku/ch-2.raku
+++ b/challenge-090/garrett-goebel/raku/ch-2.raku
@@ -1,2 +1,17 @@
 #!/usr/bin/env raku
-say TR/TAGC/ATCG/ with 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+
+unit sub MAIN (Int $A where {$A > 0} = 14, Int $B where {$B > 0} = 12);
+
+my ($a, $b, $r) = ($A, $B, 0); # command line args are immutable
+
+say "$a & $b";
+
+if ($a > 1) {
+    repeat {
+        $r += $b  if $a mod 2;
+        say "{ $a div= 2 } & { $b *= 2 } | r: $r";
+    } while $a > 1;
+}
+$r += $b;
+
+say "r: $r";
-- 
cgit 


From 84fd44fc915d5ea833e83d2a91114553c18e9438 Mon Sep 17 00:00:00 2001
From: Garrett Goebel <garrett.goebel@gmail.com>
Date: Tue, 8 Dec 2020 19:51:18 -0500
Subject: challenge-090 Task 2 Raku tweaks

---
 challenge-090/garrett-goebel/raku/ch-2.raku | 24 +++++++++++++-----------
 1 file changed, 13 insertions(+), 11 deletions(-)

(limited to 'challenge-090')

diff --git a/challenge-090/garrett-goebel/raku/ch-2.raku b/challenge-090/garrett-goebel/raku/ch-2.raku
index 35324621de..dede70ec31 100644
--- a/challenge-090/garrett-goebel/raku/ch-2.raku
+++ b/challenge-090/garrett-goebel/raku/ch-2.raku
@@ -1,17 +1,19 @@
 #!/usr/bin/env raku
 
-unit sub MAIN (Int $A where {$A > 0} = 14, Int $B where {$B > 0} = 12);
+unit sub MAIN (
+    Int $A is copy where $A > 0 = 14,
+    Int $B is copy where $B > 0 = 12
+);
 
-my ($a, $b, $r) = ($A, $B, 0); # command line args are immutable
+my Int $r = 0;
+my $format = "%10d & %10d | product: %10d\n";
+$format.printf($A,$B, $r);
 
-say "$a & $b";
-
-if ($a > 1) {
+if ($A > 1) {
     repeat {
-        $r += $b  if $a mod 2;
-        say "{ $a div= 2 } & { $b *= 2 } | r: $r";
-    } while $a > 1;
+        $r += $B  if $A mod 2;
+        $format.printf($A div= 2, $B *= 2, $r);
+    } while $A > 1;
 }
-$r += $b;
-
-say "r: $r";
+$r += $B;
+~(' ' x 24 ~ "| product: %10d\n").printf($r);
-- 
cgit 


From 7a81a293415612144e83f99a11c04190727814d6 Mon Sep 17 00:00:00 2001
From: Mohammad S Anwar <mohammad.anwar@yahoo.com>
Date: Wed, 9 Dec 2020 04:47:45 +0000
Subject: - Added solutions by Pete Houston.

---
 challenge-090/pete-houston/perl/ch-1.pl | 27 ++++++++++++
 challenge-090/pete-houston/perl/ch-2.pl | 77 +++++++++++++++++++++++++++++++++
 2 files changed, 104 insertions(+)
 create mode 100644 challenge-090/pete-houston/perl/ch-1.pl
 create mode 100644 challenge-090/pete-houston/perl/ch-2.pl

(limited to 'challenge-090')

diff --git a/challenge-090/pete-houston/perl/ch-1.pl b/challenge-090/pete-houston/perl/ch-1.pl
new file mode 100644
index 0000000000..e35a0078df
--- /dev/null
+++ b/challenge-090/pete-houston/perl/ch-1.pl
@@ -0,0 +1,27 @@
+#!/usr/bin/env perl 
+#===============================================================================
+#
+#         FILE: 9001.pl
+#
+#        USAGE: ./9001.pl STRING
+#
+#  DESCRIPTION: DNA nucleobase counts and complementary sequence
+#
+#        NOTES: STRING must contain uppercase A, C, G and T characters
+#         BUGS: uses string eval *shudder*
+#       AUTHOR: Pete Houston (pete), cpan@openstrike.co.uk
+# ORGANIZATION: Openstrike
+#      VERSION: 1.0
+#      CREATED: 07/12/20
+#===============================================================================
+
+use strict;
+use warnings;
+
+my $dna = shift;
+for my $base (qw/A C G T/) {
+	printf "Count of $base is %i\n", eval "\$dna =~ tr/$base/$base/;";
+}
+print "Original sequence is $dna\n";
+$dna =~ tr/ACGT/TGCA/;
+print "Complementary sequence is $dna\n";
diff --git a/challenge-090/pete-houston/perl/ch-2.pl b/challenge-090/pete-houston/perl/ch-2.pl
new file mode 100644
index 0000000000..ba80f52e08
--- /dev/null
+++ b/challenge-090/pete-houston/perl/ch-2.pl
@@ -0,0 +1,77 @@
+#!/usr/bin/env perl 
+#===============================================================================
+#
+#         FILE: 9002.pl
+#
+#        USAGE: ./9002.pl [-q] N M
+#
+#  DESCRIPTION: Ethiopian multiplication showing working out.
+#
+#      OPTIONS: -q to hide working out
+# REQUIREMENTS: Getopt::Std
+#       AUTHOR: Pete Houston (pete), cpan@openstrike.co.uk
+# ORGANIZATION: Openstrike
+#      VERSION: 1.0
+#      CREATED: 07/12/20
+#===============================================================================
+
+use strict;
+use warnings;
+
+use Getopt::Std;
+$Getopt::Std::STANDARD_HELP_VERSION = 1;
+*HELP_MESSAGE = \&usage;
+our $VERSION = '1.00';
+
+# Get option
+my %opts;
+getopts ('q', \%opts) or usage ();
+
+# Validate arguments
+my ($n, $m) = @ARGV;
+for ($n, $m) {
+	usage () unless defined && /^[0-9]+$/ && $_ >= 1;
+}
+
+# Process the multiplication
+verbose ("Starting with $n and $m we iterate by halving and doubling\n");
+
+my $tot     = 0;
+my $target  = $n * $m;
+my $prodstr = "$n * $m";
+
+while (1) {
+	verbose (sprintf "%5i, %5i\n", $n, $m);
+	if ($n % 2) {
+		$tot += $m;
+		verbose ("  $n is odd so add this value of $m " .
+			"to give a running total of $tot\n");
+	} else {
+		verbose ("  $n is even so ignore this value of $m\n");
+
+	}
+	if ($n == 1) {
+		verbose ("  n is $n, so we are finished and the result is $tot\n");
+		print "$prodstr = $tot\n";
+		if ($target != $tot) {
+			die q#Hey, wait just a minute. That's not right, # .
+				"it should be $tot.\n" .
+				"You've managed to break Ethiopian Multiplication!\n";
+		}
+		exit;
+	}
+	$n = int ($n / 2);
+	$m *= 2;
+}
+
+sub usage {
+	die <<EOT;
+Usage: $0 [ -q ] N M
+
+	where N and M must be natural numbers.
+	-q enables quiet mode
+
+EOT
+}
+
+sub verbose { print shift unless $opts{q} }
-- 
cgit 


From 48118ab04e8fb1f5164e9712d28a2b1877aa2a9f Mon Sep 17 00:00:00 2001
From: Mohammad S Anwar <mohammad.anwar@yahoo.com>
Date: Wed, 9 Dec 2020 04:55:53 +0000
Subject: - Added solutions by Laurent Rosenfeld.

---
 challenge-090/laurent-rosenfeld/blog.txt       |  1 +
 challenge-090/laurent-rosenfeld/perl/ch-1.pl   | 12 ++++++++++++
 challenge-090/laurent-rosenfeld/perl/ch-2.pl   | 12 ++++++++++++
 challenge-090/laurent-rosenfeld/raku/ch-1.raku | 13 +++++++++++++
 challenge-090/laurent-rosenfeld/raku/ch-2.raku | 10 ++++++++++
 5 files changed, 48 insertions(+)
 create mode 100644 challenge-090/laurent-rosenfeld/blog.txt
 create mode 100644 challenge-090/laurent-rosenfeld/perl/ch-1.pl
 create mode 100644 challenge-090/laurent-rosenfeld/perl/ch-2.pl
 create mode 100644 challenge-090/laurent-rosenfeld/raku/ch-1.raku
 create mode 100644 challenge-090/laurent-rosenfeld/raku/ch-2.raku

(limited to 'challenge-090')

diff --git a/challenge-090/laurent-rosenfeld/blog.txt b/challenge-090/laurent-rosenfeld/blog.txt
new file mode 100644
index 0000000000..fbb7836743
--- /dev/null
+++ b/challenge-090/laurent-rosenfeld/blog.txt
@@ -0,0 +1 @@
+http://blogs.perl.org/users/laurent_r/2020/12/perl-weekly-challenge-90-dna-sequence-and-ethiopian-multiplication.html
diff --git a/challenge-090/laurent-rosenfeld/perl/ch-1.pl b/challenge-090/laurent-rosenfeld/perl/ch-1.pl
new file mode 100644
index 0000000000..bb0ca420cb
--- /dev/null
+++ b/challenge-090/laurent-rosenfeld/perl/ch-1.pl
@@ -0,0 +1,12 @@
+use strict;
+use warnings;
+use feature "say";
+
+my $dna = 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+# count
+my %histogram;
+$histogram{$_}++ for split '', $dna;
+say "$_: $histogram{$_}" for keys %histogram;
+
+# Complementary sequence
+say for "Complement:", $dna =~ tr/TAGC/ATCG/r;
diff --git a/challenge-090/laurent-rosenfeld/perl/ch-2.pl b/challenge-090/laurent-rosenfeld/perl/ch-2.pl
new file mode 100644
index 0000000000..0b8ef08383
--- /dev/null
+++ b/challenge-090/laurent-rosenfeld/perl/ch-2.pl
@@ -0,0 +1,12 @@
+use strict;
+use warnings;
+use feature "say";
+
+my ($c, $d) = @ARGV;
+my $result = $c % 2 ? $d : 0;
+while ($c > 1) {
+    $c = $c >> 1; # right shift 1 bit = div by 2
+    $d *= 2;
+    $result += $d if $c % 2;
+}
+say $result;
diff --git a/challenge-090/laurent-rosenfeld/raku/ch-1.raku b/challenge-090/laurent-rosenfeld/raku/ch-1.raku
new file mode 100644
index 0000000000..16c141c593
--- /dev/null
+++ b/challenge-090/laurent-rosenfeld/raku/ch-1.raku
@@ -0,0 +1,13 @@
+use v6;
+
+my $dna = 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+
+# count
+my %histo;
+%histo{$_}++ for $dna.comb;
+say "Histogram:";
+.say for %histo.pairs;
+
+# Complementary sequence
+my %complement = T => 'A', A => 'T', G => 'C', C => 'G';
+.say for "Complement:", $dna.comb.map({%complement{$_}}).join: '';
diff --git a/challenge-090/laurent-rosenfeld/raku/ch-2.raku b/challenge-090/laurent-rosenfeld/raku/ch-2.raku
new file mode 100644
index 0000000000..8c1d413537
--- /dev/null
+++ b/challenge-090/laurent-rosenfeld/raku/ch-2.raku
@@ -0,0 +1,10 @@
+use v6;
+
+my ($a, $b) = map {$_.Int}, @*ARGS;
+my $result = $a % 2 ?? $b !! 0;
+while $a > 1 {
+    $a div= 2;
+    $b *= 2;
+    $result += $b if $a % 2;
+}
+say $result;
-- 
cgit