Task 1: "DNA Sequence

DNA is a long, chainlike molecule which has two strands twisted into
a double helix. The two strands are made up of simpler molecules
called nucleotides. Each nucleotide is composed of one of the four
nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A)
and thymine (T).

You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.

Write a script to print nucleobase count in the given DNA sequence. Also
print the complementary sequence where Thymine (T) on one strand is
always facing an adenine (A) and vice versa; guanine (G) is always facing
a cytosine (C) and vice versa.

To get the complementary sequence use the following mapping:

T => A
A => T
G => C
C => G
"

My notes: very clearly defined, simple to do.


Task 2: "Ethiopian Multiplication

You are given two positive numbers $A and $B.

Write a script to demonstrate 

https://rosettacode.org/wiki/Ethiopian_multiplication

using the given numbers.
"

My notes: clearly defined, once you follow the link and discover what Ethiopian Multiplication is:-)
Exercise for the interested reader: why does the method work?  It follows directly from how BINARY
multiplication actually works.