#!/usr/bin/env lua require 'busted.runner'() describe("Task 1, DNA Sequence", function() local t1 = require'ch-1' it("produces correct results for the examples", function() local freq, complement = t1.process_dna(t1.DEFAULT_DNA) assert.are.same({G=13, T=22, A=14, C=18 }, freq) assert.are.same('CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC', complement) end) end) describe("Task 2, Ethiopian Multiplication", function() local t2 = require'ch-2' it("produces correct results for the examples", function() assert.are.same(168, t2.ethiopian_multiply(12, 14)) assert.are.same(1554, t2.ethiopian_multiply(37, 42)) end) end)