aboutsummaryrefslogtreecommitdiff
diff options
context:
space:
mode:
authorMohammad S Anwar <mohammad.anwar@yahoo.com>2020-12-13 04:27:23 +0000
committerMohammad S Anwar <mohammad.anwar@yahoo.com>2020-12-13 04:27:23 +0000
commit18a3ee748620202bd54394fb37b60bb777f5833e (patch)
tree946c6204b00b102467d5556e9fc749433490d8a1
parent5bb5ab88879af0913bca6e6ad8f34bcebc1c6494 (diff)
downloadperlweeklychallenge-club-18a3ee748620202bd54394fb37b60bb777f5833e.tar.gz
perlweeklychallenge-club-18a3ee748620202bd54394fb37b60bb777f5833e.tar.bz2
perlweeklychallenge-club-18a3ee748620202bd54394fb37b60bb777f5833e.zip
- Added solutions by Athanasius.
Diffstat
-rw-r--r--challenge-090/athanasius/perl/ch-1.pl69
-rw-r--r--challenge-090/athanasius/perl/ch-2.pl115
-rw-r--r--challenge-090/athanasius/raku/ch-1.raku64
-rw-r--r--challenge-090/athanasius/raku/ch-2.raku86
-rw-r--r--stats/pwc-current.json279
-rw-r--r--stats/pwc-language-breakdown-summary.json88
-rw-r--r--stats/pwc-language-breakdown.json672
-rw-r--r--stats/pwc-leaders.json378
-rw-r--r--stats/pwc-summary-1-30.json34
-rw-r--r--stats/pwc-summary-121-150.json32
-rw-r--r--stats/pwc-summary-151-180.json124
-rw-r--r--stats/pwc-summary-181-210.json28
-rw-r--r--stats/pwc-summary-31-60.json118
-rw-r--r--stats/pwc-summary-61-90.json126
-rw-r--r--stats/pwc-summary-91-120.json38
-rw-r--r--stats/pwc-summary.json474
16 files changed, 1539 insertions, 1186 deletions
diff --git a/challenge-090/athanasius/perl/ch-1.pl b/challenge-090/athanasius/perl/ch-1.pl
new file mode 100644
index 0000000000..349c0fb1c4
--- /dev/null
+++ b/challenge-090/athanasius/perl/ch-1.pl
@@ -0,0 +1,69 @@
+#!perl
+
+###############################################################################
+=comment
+
+Perl Weekly Challenge 090
+=========================
+
+Task #1
+-------
+*DNA Sequence*
+
+Submitted by: Mohammad S Anwar
+
+DNA is a long, chainlike molecule which has two strands twisted into a double
+helix. The two strands are made up of simpler molecules called nucleotides.
+Each nucleotide is composed of one of the four nitrogen-containing nucleobases
+cytosine (C), guanine (G), adenine (A) and thymine (T).
+
+You are given DNA sequence,
+GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+
+Write a script to print nucleobase count in the given DNA sequence. Also print
+the complementary sequence where Thymine (T) on one strand is always facing an
+adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and
+vice versa.
+
+To get the complementary sequence use the following mapping:
+
+ T => A
+ A => T
+ G => C
+ C => G
+
+=cut
+###############################################################################
+
+#--------------------------------------#
+# Copyright © 2020 PerlMonk Athanasius #
+#--------------------------------------#
+
+use strict;
+use warnings;
+use Const::Fast;
+
+const my $DNA_SEQ =>
+ 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+
+#------------------------------------------------------------------------------
+BEGIN
+#------------------------------------------------------------------------------
+{
+ $| = 1;
+ print "\nChallenge 090, Task #1: DNA Sequence (Perl)\n\n";
+}
+
+#==============================================================================
+MAIN:
+#==============================================================================
+{
+ $DNA_SEQ =~ / ( [^CGAT] ) /x
+ and die qq[ERROR: Invalid nucleotide "$1" found in DNA sequence\n];
+
+ printf "DNA sequence:\n %s\n\n", $DNA_SEQ;
+ printf "Nucleobase count:\n %d\n\n", length $DNA_SEQ;
+ printf "Complementary sequence:\n %s\n", $DNA_SEQ =~ tr/TAGC/ATCG/r;
+}
+
+###############################################################################
diff --git a/challenge-090/athanasius/perl/ch-2.pl b/challenge-090/athanasius/perl/ch-2.pl
new file mode 100644
index 0000000000..6ede35c99f
--- /dev/null
+++ b/challenge-090/athanasius/perl/ch-2.pl
@@ -0,0 +1,115 @@
+#!perl
+
+###############################################################################
+=comment
+
+Perl Weekly Challenge 090
+=========================
+
+Task #2
+-------
+*Ethiopian Multiplication*
+
+Submitted by: Mohammad S Anwar
+
+You are given two positive numbers $A and $B.
+
+Write a script to demonstrate [https://threesixty360.wordpress.com/2009/06/09/
+ethiopian-multiplication/|Ethiopian Multiplication] using the given numbers.
+
+=cut
+###############################################################################
+
+#--------------------------------------#
+# Copyright © 2020 PerlMonk Athanasius #
+#--------------------------------------#
+
+use strict;
+use warnings;
+use Const::Fast;
+use Regexp::Common qw( number );
+
+const my $USAGE =>
+"Usage:
+ perl $0 <A> <B>
+
+ <A> A positive integer (the multiplier)
+ <B> A positive integer (the multiplicand)\n";
+
+#------------------------------------------------------------------------------
+BEGIN
+#------------------------------------------------------------------------------
+{
+ $| = 1;
+ print "\nChallenge 090, Task #2: Ethiopian Multiplication (Perl)\n\n";
+}
+
+#==============================================================================
+MAIN:
+#==============================================================================
+{
+ my ($A, $B) = parse_command_line();
+ my $lhs = $A;
+ my $rhs = $B;
+ my $l_width = length $lhs;
+ my $r_width = length $rhs * (2 ** int(log($lhs) / log(2)));
+ my @terms;
+
+ while ($lhs >= 1)
+ {
+ my $action = 'ignore';
+
+ if ($lhs % 2 == 1)
+ {
+ $action = 'add';
+ push @terms, $rhs;
+ }
+
+ printf "%*d & %*d --> %s\n", $l_width, $lhs, $r_width, $rhs, $action;
+
+ $lhs = int($lhs / 2);
+ $rhs *= 2;
+ }
+
+ my $sum = 0;
+ $sum += $_ for @terms;
+
+ printf "\n%d * %d = %s\n", $A, $B, join ' + ', @terms;
+ printf "%s = %d\n", ' ' x ($l_width + 3 + length $B), $sum;
+
+ my $product = $A * $B;
+
+ $sum == $product or die "ERROR: product is $sum, should be $product\n";
+}
+
+#------------------------------------------------------------------------------
+sub parse_command_line
+#------------------------------------------------------------------------------
+{
+ my $args = scalar @ARGV;
+
+ $args == 0 and error( 'No command-line arguments found' );
+ $args == 2 or error( 'Incorrect number of command-line arguments' );
+
+ my $A = $ARGV[0];
+ my $B = $ARGV[1];
+
+ for ($A, $B)
+ {
+ / \A $RE{num}{int} \z /x or error( qq["$_" is not an integer] );
+ $_ > 0 or error( qq["$_" is not positive] );
+ }
+
+ return ($A, $B);
+}
+
+#------------------------------------------------------------------------------
+sub error
+#------------------------------------------------------------------------------
+{
+ my ($message) = @_;
+
+ die "ERROR: $message\n$USAGE";
+}
+
+###############################################################################
diff --git a/challenge-090/athanasius/raku/ch-1.raku b/challenge-090/athanasius/raku/ch-1.raku
new file mode 100644
index 0000000000..2683844c6f
--- /dev/null
+++ b/challenge-090/athanasius/raku/ch-1.raku
@@ -0,0 +1,64 @@
+use v6d;
+
+###############################################################################
+=begin comment
+
+Perl Weekly Challenge 090
+=========================
+
+Task #1
+-------
+*DNA Sequence*
+
+Submitted by: Mohammad S Anwar
+
+DNA is a long, chainlike molecule which has two strands twisted into a double
+helix. The two strands are made up of simpler molecules called nucleotides.
+Each nucleotide is composed of one of the four nitrogen-containing nucleobases
+cytosine (C), guanine (G), adenine (A) and thymine (T).
+
+You are given DNA sequence,
+GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+
+Write a script to print nucleobase count in the given DNA sequence. Also print
+the complementary sequence where Thymine (T) on one strand is always facing an
+adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and
+vice versa.
+
+To get the complementary sequence use the following mapping:
+
+ T => A
+ A => T
+ G => C
+ C => G
+
+=end comment
+###############################################################################
+
+#--------------------------------------#
+# Copyright © 2020 PerlMonk Athanasius #
+#--------------------------------------#
+
+my Str constant $DNA-SEQ =
+ 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+
+#------------------------------------------------------------------------------
+BEGIN
+#------------------------------------------------------------------------------
+{
+ "\nChallenge 090, Task #1: DNA Sequence (Raku)\n".put;
+}
+
+#==============================================================================
+sub MAIN()
+#==============================================================================
+{
+ $DNA-SEQ ~~ / ( <-[CGAT]> ) /
+ and die qq[ERROR: Invalid nucleotide "$0" found in DNA sequence\n];
+
+ "DNA sequence:\n %s\n\n"\ .printf: $DNA-SEQ;
+ "Nucleobase count:\n %d\n\n"\ .printf: $DNA-SEQ.chars;
+ "Complementary sequence:\n %s\n".printf: TR/TAGC/ATCG/ with $DNA-SEQ;
+}
+
+##############################################################################
diff --git a/challenge-090/athanasius/raku/ch-2.raku b/challenge-090/athanasius/raku/ch-2.raku
new file mode 100644
index 0000000000..64901df805
--- /dev/null
+++ b/challenge-090/athanasius/raku/ch-2.raku
@@ -0,0 +1,86 @@
+use v6d;
+
+###############################################################################
+=begin comment
+
+Perl Weekly Challenge 090
+=========================
+
+Task #2
+-------
+*Ethiopian Multiplication*
+
+Submitted by: Mohammad S Anwar
+
+You are given two positive numbers $A and $B.
+
+Write a script to demonstrate [https://threesixty360.wordpress.com/2009/06/09/
+ethiopian-multiplication/|Ethiopian Multiplication] using the given numbers.
+
+=end comment
+###############################################################################
+
+#--------------------------------------#
+# Copyright © 2020 PerlMonk Athanasius #
+#--------------------------------------#
+
+#------------------------------------------------------------------------------
+BEGIN
+#------------------------------------------------------------------------------
+{
+ "\nChallenge 090, Task #2: Ethiopian Multiplication (Raku)\n".put;
+}
+
+subset Pos of Int where * > 0;
+
+#==============================================================================
+sub MAIN
+(
+ Pos:D $A, #= A positive integer (the multiplier)
+ Pos:D $B #= A positive integer (the multiplicand)
+)
+#==============================================================================
+{
+ my UInt $lhs = $A;
+ my Pos $rhs = $B;
+ my Pos $l-width = $lhs.chars;
+ my Pos $r-width = ($rhs * (2 ** floor(log2 $lhs))).chars;
+ my Pos @terms;
+
+ while $lhs >= 1
+ {
+ my Str $action = 'ignore';
+
+ if $lhs % 2 == 1
+ {
+ $action = 'add';
+ @terms.push: $rhs;
+ }
+
+ "%*d & %*d --> %s\n".printf: $l-width, $lhs, $r-width, $rhs, $action;
+
+ $lhs = floor($lhs / 2);
+ $rhs *= 2;
+ }
+
+ my UInt $sum = @terms.sum;
+
+ "\n%d * %d = %s\n".printf: $A, $B, @terms.join: ' + ';
+ "%s = %d\n"\ .printf: ' ' x ($l-width + 3 + $B.chars), $sum;
+
+ my Pos $product = $A * $B;
+
+ $sum == $product or die "ERROR: Product is $sum, should be $product\n";
+}
+
+#------------------------------------------------------------------------------
+sub USAGE()
+#------------------------------------------------------------------------------
+{
+ my Str $usage = $*USAGE;
+
+ $usage ~~ s/ ($*PROGRAM-NAME) /raku $0/;
+ $usage.put;
+}
+
+##############################################################################
diff --git a/stats/pwc-current.json b/stats/pwc-current.json
index 19400e9cbd..8e2d6fa3d8 100644
--- a/stats/pwc-current.json
+++ b/stats/pwc-current.json
@@ -1,8 +1,20 @@
{
+ "title" : {
+ "text" : "Perl Weekly Challenge - 090"
+ },
+ "yAxis" : {
+ "title" : {
+ "text" : "Total Solutions"
+ }
+ },
+ "xAxis" : {
+ "type" : "category"
+ },
"drilldown" : {
"series" : [
{
"id" : "Aaron Smith",
+ "name" : "Aaron Smith",
"data" : [
[
"Raku",
@@ -12,8 +24,7 @@
"Blog",
1
]
- ],
- "name" : "Aaron Smith"
+ ]
},
{
"data" : [
@@ -22,20 +33,22 @@
2
]
],
- "id" : "Alexander Karelas",
- "name" : "Alexander Karelas"
+ "name" : "Alexander Karelas",
+ "id" : "Alexander Karelas"
},
{
+ "id" : "Alexander Pankoff",
"name" : "Alexander Pankoff",
"data" : [
[
"Perl",
2
]
- ],
- "id" : "Alexander Pankoff"
+ ]
},
{
+ "id" : "Andinus",
+ "name" : "Andinus",
"data" : [
[
"Raku",
@@ -45,21 +58,20 @@
"Blog",
1
]
- ],
- "id" : "Andinus",
- "name" : "Andinus"
+ ]
},
{
- "name" : "Andrew Shitov",
- "id" : "Andrew Shitov",
"data" : [
[
"Raku",
2
]
- ]
+ ],
+ "name" : "Andrew Shitov",
+ "id" : "Andrew Shitov"
},
{
+ "id" : "Arne Sommer",
"data" : [
[
"Perl",
@@ -74,21 +86,33 @@
1
]
],
- "id" : "Arne Sommer",
"name" : "Arne Sommer"
},
{
- "name" : "Cristina Heredia",
+ "data" : [
+ [
+ "Perl",
+ 2
+ ],
+ [
+ "Raku",
+ 2
+ ]
+ ],
+ "name" : "Athanasius",
+ "id" : "Athanasius"
+ },
+ {
"id" : "Cristina Heredia",
"data" : [
[
"Perl",
1
]
- ]
+ ],
+ "name" : "Cristina Heredia"
},
{
- "name" : "Dave Jacoby",
"id" : "Dave Jacoby",
"data" : [
[
@@ -99,27 +123,28 @@
"Blog",
1
]
- ]
+ ],
+ "name" : "Dave Jacoby"
},
{
+ "id" : "E. Choroba",
"name" : "E. Choroba",
"data" : [
[
"Perl",
2
]
- ],
- "id" : "E. Choroba"
+ ]
},
{
- "id" : "Feng Chang",
+ "name" : "Feng Chang",
"data" : [
[
"Raku",
2
]
],
- "name" : "Feng Chang"
+ "id" : "Feng Chang"
},
{
"name" : "Flavio Poletti",
@@ -137,33 +162,33 @@
},
{
"name" : "Garrett Goebel",
- "id" : "Garrett Goebel",
"data" : [
[
"Raku",
2
]
- ]
+ ],
+ "id" : "Garrett Goebel"
},
{
+ "id" : "James Smith",
"data" : [
[
"Perl",
2
]
],
- "id" : "James Smith",
"name" : "James Smith"
},
{
- "name" : "Jan Krnavek",
- "id" : "Jan Krnavek",
"data" : [
[
"Raku",
2
]
- ]
+ ],
+ "name" : "Jan Krnavek",
+ "id" : "Jan Krnavek"
},
{
"id" : "Joel Crosswhite",
@@ -176,14 +201,14 @@
"name" : "Joel Crosswhite"
},
{
- "id" : "Jorg Sommrey",
"data" : [
[
"Perl",
2
]
],
- "name" : "Jorg Sommrey"
+ "name" : "Jorg Sommrey",
+ "id" : "Jorg Sommrey"
},
{
"name" : "Julio de Castro",
@@ -200,7 +225,6 @@
"id" : "Julio de Castro"
},
{
- "name" : "Kang-min Liu",
"data" : [
[
"Raku",
@@ -211,11 +235,10 @@
2
]
],
+ "name" : "Kang-min Liu",
"id" : "Kang-min Liu"
},
{
- "name" : "Laurent Rosenfeld",
- "id" : "Laurent Rosenfeld",
"data" : [
[
"Perl",
@@ -229,57 +252,59 @@
"Blog",
1
]
- ]
+ ],
+ "name" : "Laurent Rosenfeld",
+ "id" : "Laurent Rosenfeld"
},
{
- "name" : "Mark Anderson",
+ "id" : "Mark Anderson",
"data" : [
[
"Raku",
2
]
],
- "id" : "Mark Anderson"
+ "name" : "Mark Anderson"
},
{
+ "id" : "Mihail Iosilevitch",
"data" : [
[
"Raku",
2
]
],
- "id" : "Mihail Iosilevitch",
"name" : "Mihail Iosilevitch"
},
{
"id" : "Niels van Dijke",
+ "name" : "Niels van Dijke",
"data" : [
[
"Perl",
2
]
- ],
- "name" : "Niels van Dijke"
+ ]
},
{
+ "id" : "Nuno Vieira",
+ "name" : "Nuno Vieira",
"data" : [
[
"Perl",
2
]
- ],
- "id" : "Nuno Vieira",
- "name" : "Nuno Vieira"
+ ]
},
{
+ "name" : "Pete Houston",
"data" : [
[
"Perl",
2
]
],
- "id" : "Pete Houston",
- "name" : "Pete Houston"
+ "id" : "Pete Houston"
},
{
"data" : [
@@ -288,11 +313,10 @@
2
]
],
- "id" : "Philip Hood",
- "name" : "Philip Hood"
+ "name" : "Philip Hood",
+ "id" : "Philip Hood"
},
{
- "name" : "Roger Bell_West",
"id" : "Roger Bell_West",
"data" : [
[
@@ -303,11 +327,12 @@
"Raku",
2
]
- ]
+ ],
+ "name" : "Roger Bell_West"
},
{
- "name" : "Simon Proctor",
"id" : "Simon Proctor",
+ "name" : "Simon Proctor",
"data" : [
[
"Raku",
@@ -316,16 +341,17 @@
]
},
{
+ "id" : "Stuart Little",
"name" : "Stuart Little",
"data" : [
[
"Raku",
2
]
- ],
- "id" : "Stuart Little"
+ ]
},
{
+ "name" : "Ulrich Rieke",
"data" : [
[
"Perl",
@@ -336,11 +362,9 @@
2
]
],
- "id" : "Ulrich Rieke",
- "name" : "Ulrich Rieke"
+ "id" : "Ulrich Rieke"
},
{
- "id" : "W. Luis Mochan",
"data" : [
[
"Perl",
@@ -351,21 +375,43 @@
1
]
],
- "name" : "W. Luis Mochan"
+ "name" : "W. Luis Mochan",
+ "id" : "W. Luis Mochan"
}
]
},
+ "plotOptions" : {
+ "series" : {
+ "borderWidth" : 0,
+ "dataLabels" : {
+ "format" : "{point.y}",
+ "enabled" : 1
+ }
+ }
+ },
+ "chart" : {
+ "type" : "column"
+ },
+ "subtitle" : {
+ "text" : "[Champions: 31] Last updated at 2020-12-13 04:26:58 GMT"
+ },
+ "tooltip" : {
+ "headerFormat" : "<span style='font-size:11px'>{series.name}</span><br/>",
+ "followPointer" : 1,
+ "pointFormat" : "<span style='color:{point.color}'>{point.name}</span>: <b>{point.y:f}</b><br/>"
+ },
"series" : [
{
+ "colorByPoint" : 1,
"data" : [
{
- "drilldown" : "Aaron Smith",
+ "y" : 3,
"name" : "Aaron Smith",
- "y" : 3
+ "drilldown" : "Aaron Smith"
},
{
- "drilldown" : "Alexander Karelas",
"y" : 2,
+ "drilldown" : "Alexander Karelas",
"name" : "Alexander Karelas"
},
{
@@ -374,44 +420,49 @@
"y" : 2
},
{
+ "name" : "Andinus",
"drilldown" : "Andinus",
- "y" : 2,
- "name" : "Andinus"
+ "y" : 2
},
{
+ "name" : "Andrew Shitov",
"drilldown" : "Andrew Shitov",
- "y" : 2,
- "name" : "Andrew Shitov"
+ "y" : 2
},
{
- "name" : "Arne Sommer",
"y" : 5,
+ "name" : "Arne Sommer",
"drilldown" : "Arne Sommer"
},
{
+ "y" : 4,
+ "name" : "Athanasius",
+ "drilldown" : "Athanasius"
+ },
+ {
+ "drilldown" : "Cristina Heredia",
"name" : "Cristina Heredia",
- "y" : 1,
- "drilldown" : "Cristina Heredia"
+ "y" : 1
},
{
- "drilldown" : "Dave Jacoby",
"y" : 3,
- "name" : "Dave Jacoby"
+ "name" : "Dave Jacoby",
+ "drilldown" : "Dave Jacoby"
},
{
- "drilldown" : "E. Choroba",
"y" : 2,
- "name" : "E. Choroba"
+ "name" : "E. Choroba",
+ "drilldown" : "E. Choroba"
},
{
- "name" : "Feng Chang",
"y" : 2,
- "drilldown" : "Feng Chang"
+ "drilldown" : "Feng Chang",
+ "name" : "Feng Chang"
},
{
- "drilldown" : "Flavio Poletti",
+ "y" : 4,
"name" : "Flavio Poletti",
- "y" : 4
+ "drilldown" : "Flavio Poletti"
},
{
"drilldown" : "Garrett Goebel",
@@ -419,24 +470,24 @@
"y" : 2
},
{
+ "name" : "James Smith",
"drilldown" : "James Smith",
- "y" : 2,
- "name" : "James Smith"
+ "y" : 2
},
{
"y" : 2,
- "name" : "Jan Krnavek",
- "drilldown" : "Jan Krnavek"
+ "drilldown" : "Jan Krnavek",
+ "name" : "Jan Krnavek"
},
{
- "name" : "Joel Crosswhite",
"y" : 2,
+ "name" : "Joel Crosswhite",
"drilldown" : "Joel Crosswhite"
},
{
"name" : "Jorg Sommrey",
- "y" : 2,
- "drilldown" : "Jorg Sommrey"
+ "drilldown" : "Jorg Sommrey",
+ "y" : 2
},
{
"y" : 4,
@@ -444,13 +495,13 @@
"drilldown" : "Julio de Castro"
},
{
- "y" : 4,
+ "drilldown" : "Kang-min Liu",
"name" : "Kang-min Liu",
- "drilldown" : "Kang-min Liu"
+ "y" : 4
},
{
- "name" : "Laurent Rosenfeld",
"y" : 5,
+ "name" : "Laurent Rosenfeld",
"drilldown" : "Laurent Rosenfeld"
},
{
@@ -460,38 +511,38 @@
},
{
"y" : 2,
- "name" : "Mihail Iosilevitch",
- "drilldown" : "Mihail Iosilevitch"
+ "drilldown" : "Mihail Iosilevitch",
+ "name" : "Mihail Iosilevitch"
},
{
- "drilldown" : "Niels van Dijke",
"name" : "Niels van Dijke",
+ "drilldown" : "Niels van Dijke",
"y" : 2
},
{
- "name" : "Nuno Vieira",
"y" : 2,
+ "name" : "Nuno Vieira",
"drilldown" : "Nuno Vieira"
},
{
+ "drilldown" : "Pete Houston",
"name" : "Pete Houston",
- "y" : 2,
- "drilldown" : "Pete Houston"
+ "y" : 2
},
{
- "drilldown" : "Philip Hood",
+ "y" : 2,
"name" : "Philip Hood",
- "y" : 2
+ "drilldown" : "Philip Hood"
},
{
+ "name" : "Roger Bell_West",
"drilldown" : "Roger Bell_West",
- "y" : 4,
- "name" : "Roger Bell_West"
+ "y" : 4
},
{
+ "name" : "Simon Proctor",
"drilldown" : "Simon Proctor",
- "y" : 2,
- "name" : "Simon Proctor"
+ "y" : 2
},
{
"drilldown" : "Stuart Little",
@@ -499,52 +550,20 @@
"y" : 2
},
{
+ "name" : "Ulrich Rieke",
"drilldown" : "Ulrich Rieke",
- "y" : 4,
- "name" : "Ulrich Rieke"
+ "y" : 4
},
{
- "drilldown" : "W. Luis Mochan",
"name" : "W. Luis Mochan",
+ "drilldown" : "W. Luis Mochan",
"y" : 3
}
],
- "name" : "Perl Weekly Challenge - 090",
- "colorByPoint" : 1
+ "name" : "Perl Weekly Challenge - 090"
}
],
- "subtitle" : {
- "text" : "[Champions: 30] Last updated at 2020-12-13 04:12:16 GMT"
- },
- "tooltip" : {
- "followPointer" : 1,
- "pointFormat" : "<span style='color:{point.color}'>{point.name}</span>: <b>{point.y:f}</b><br/>",
- "headerFormat" : "<span style='font-size:11px'>{series.name}</span><br/>"
- },
"legend" : {
"enabled" : 0
- },
- "xAxis" : {
- "type" : "category"
- },
- "plotOptions" : {
- "series" : {
- "borderWidth" : 0,
- "dataLabels" : {
- "enabled" : 1,
- "format" : "{point.y}"
- }
- }
- },
- "title" : {
- "text" : "Perl Weekly Challenge - 090"
- },
- "chart" : {
- "type" : "column"
- },
- "yAxis" : {
- "title" : {
- "text" : "Total Solutions"
- }
}
}
diff --git a/stats/pwc-language-breakdown-summary.json b/stats/pwc-language-breakdown-summary.json
index 2ee82c00c4..97a3599ce3 100644
--- a/stats/pwc-language-breakdown-summary.json
+++ b/stats/pwc-language-breakdown-summary.json
@@ -1,9 +1,48 @@
{
+ "chart" : {
+ "type" : "column"
+ },
"subtitle" : {
- "text" : "Last updated at 2020-12-13 04:12:16 GMT"
+ "text" : "Last updated at 2020-12-13 04:26:58 GMT"
+ },
+ "title" : {
+ "text" : "Perl Weekly Challenge Contributions [2019 - 2020]"
+ },
+ "xAxis" : {
+ "type" : "category",
+ "labels" : {
+ "style" : {
+ "fontSize" : "13px",
+ "fontFamily" : "Verdana, sans-serif"
+ }
+ }
+ },
+ "yAxis" : {
+ "title" : {
+ "text" : null
+ },
+ "min" : 0
+