Add Lua and Python solutions to challenge 090

8 files changed, 405 insertions, 30 deletions

diff --git a/challenge-090/paulo-custodio/forth/ch-2.fs b/challenge-090/paulo-custodio/forth/ch-2.fs
index 134fd22e16..3e72d78a3f 100644
--- a/challenge-090/paulo-custodio/forth/ch-2.fs
+++ b/challenge-090/paulo-custodio/forth/ch-2.fs
@@ -5,9 +5,6 @@
 \
 \ Write a script to demonstrate Ethiopian Multiplication using the given numbers.
 
-\ Start the script with A and B in the stack, e.g.
-\   gforth -e '14 12' ch-1.fs
-
 \ The solution is just as described in the algorithm, using locals to
 \ simplify the stack juggling.
 
@@ -23,5 +20,7 @@
     AGAIN
 ;
 
-\ input in stack
+\ input to stack
+NEXT-ARG S>NUMBER? 0= THROW DROP
+NEXT-ARG S>NUMBER? 0= THROW DROP
 mult . CR BYE
diff --git a/challenge-090/paulo-custodio/lua/ch-1.lua b/challenge-090/paulo-custodio/lua/ch-1.lua
new file mode 100644
index 0000000000..021f4c3a90
--- /dev/null
+++ b/challenge-090/paulo-custodio/lua/ch-1.lua
@@ -0,0 +1,32 @@
+#!/usr/bin/env lua
+
+--[[
+Challenge 090
+
+TASK #1 > DNA Sequence
+Submitted by: Mohammad S Anwar
+DNA is a long, chainlike molecule which has two strands twisted into a
+double helix. The two strands are made up of simpler molecules called
+nucleotides. Each nucleotide is composed of one of the four nitrogen-containing
+nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).
+
+You are given DNA sequence,
+GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+
+Write a script to print nucleiobase count in the given DNA sequence.
+Also print the complementary sequence where Thymine (T) on one strand
+is always facing an adenine (A) and vice versa; guanine (G) is always
+facing a cytosine (C) and vice versa.
+--]]
+
+function complement(seq)
+	local trans = {T = "A", A = "T", G = "C", C = "G"}
+	local compl = string.gsub(seq, "[TAGC]", trans)
+	return compl
+end
+
+seq = arg[1]
+compl = complement(seq)
+
+io.write(#seq, "\n")
+io.write(compl)
diff --git a/challenge-090/paulo-custodio/lua/ch-2.lua b/challenge-090/paulo-custodio/lua/ch-2.lua
new file mode 100644
index 0000000000..c93074b04f
--- /dev/null
+++ b/challenge-090/paulo-custodio/lua/ch-2.lua
@@ -0,0 +1,28 @@
+#!/usr/bin/env lua
+
+--[[
+Challenge 090
+
+TASK #2 > Ethiopian Multiplication
+Submitted by: Mohammad S Anwar
+You are given two positive numbers $a and $b.
+
+Write a script to demonstrate Ethiopian Multiplication using the given numbers.
+--]]
+
+function mul(a, b)
+	local m = 0
+	while (true) do
+		if ((a & 1) ~= 0) then
+			m = m + b
+		end
+		if (a <= 1) then
+			break
+		end
+		a = a >> 1
+		b = b << 1
+	end
+	return m
+end
+
+io.write(mul(tonumber(arg[1]), tonumber(arg[2])), "\n")
diff --git a/challenge-090/paulo-custodio/python/ch-1.py b/challenge-090/paulo-custodio/python/ch-1.py
new file mode 100644
index 0000000000..0af71bfe29
--- /dev/null
+++ b/challenge-090/paulo-custodio/python/ch-1.py
@@ -0,0 +1,27 @@
+#!/usr/bin/env python
+
+# Challenge 090
+#
+# TASK #1 > DNA Sequence
+# Submitted by: Mohammad S Anwar
+# DNA is a long, chainlike molecule which has two strands twisted into a
+# double helix. The two strands are made up of simpler molecules called
+# nucleotides. Each nucleotide is composed of one of the four nitrogen-containing
+# nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).
+#
+# You are given DNA sequence,
+# GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+#
+# Write a script to print nucleiobase count in the given DNA sequence.
+# Also print the complementary sequence where Thymine (T) on one strand
+# is always facing an adenine (A) and vice versa; guanine (G) is always
+# facing a cytosine (C) and vice versa.
+
+import sys
+import string
+
+seq = sys.argv[1]
+compl = seq.translate(str.maketrans("TAGC", "ATCG"))
+
+print(len(seq))
+print(compl)
diff --git a/challenge-090/paulo-custodio/python/ch-2.py b/challenge-090/paulo-custodio/python/ch-2.py
new file mode 100644
index 0000000000..29efd0d507
--- /dev/null
+++ b/challenge-090/paulo-custodio/python/ch-2.py
@@ -0,0 +1,24 @@
+#!/usr/bin/env python
+
+# Challenge 090
+#
+# TASK #2 > Ethiopian Multiplication
+# Submitted by: Mohammad S Anwar
+# You are given two positive numbers $a and $b.
+#
+# Write a script to demonstrate Ethiopian Multiplication using the given numbers.
+
+import sys
+
+def mul(a,b):
+    mul = 0
+    while True:
+        if (a & 1) != 0:
+            mul += b
+        if a <= 1:
+            break
+        a >>= 1
+        b <<= 1
+    return mul
+
+print(mul(int(sys.argv[1]), int(sys.argv[2])))
diff --git a/challenge-090/paulo-custodio/t/test-1.yaml b/challenge-090/paulo-custodio/t/test-1.yaml
new file mode 100644
index 0000000000..7ffbeae833
--- /dev/null
+++ b/challenge-090/paulo-custodio/t/test-1.yaml
@@ -0,0 +1,14 @@
+- setup:
+  cleanup:
+  args:     GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG
+  input:
+  output:   |
+            67
+            CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC
+- setup:
+  cleanup:
+  args:     CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC
+  input:
+  output:   |
+            67
+            GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG
diff --git a/challenge-090/paulo-custodio/t/test-2.yaml b/challenge-090/paulo-custodio/t/test-2.yaml
new file mode 100644
index 0000000000..c66b5f2e9a
--- /dev/null
+++ b/challenge-090/paulo-custodio/t/test-2.yaml
@@ -0,0 +1,275 @@
+- setup:
+  cleanup:
+  args:     0 0
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 1
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 2
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 3
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 5
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 7
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 11
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 23
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 37
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     0 47
+  intput:
+  output:   0
+- setup:
+  cleanup:
+  args:     1 1
+  intput:
+  output:   1
+- setup:
+  cleanup:
+  args:     1 2
+  intput:
+  output:   2
+- setup:
+  cleanup:
+  args:     1 3
+  intput:
+  output:   3
+- setup:
+  cleanup:
+  args:     1 5
+  intput:
+  output:   5
+- setup:
+  cleanup:
+  args:     1 7
+  intput:
+  output:   7
+- setup:
+  cleanup:
+  args:     1 11
+  intput:
+  output:   11
+- setup:
+  cleanup:
+  args:     1 23
+  intput:
+  output:   23
+- setup:
+  cleanup:
+  args:     1 37
+  intput:
+  output:   37
+- setup:
+  cleanup:
+  args:     1 47
+  intput:
+  output:   47
+- setup:
+  cleanup:
+  args:     2 2
+  intput:
+  output:   4
+- setup:
+  cleanup:
+  args:     2 3
+  intput:
+  output:   6
+- setup:
+  cleanup:
+  args:     2 5
+  intput:
+  output:   10
+- setup:
+  cleanup:
+  args:     2 7
+  intput:
+  output:   14
+- setup:
+  cleanup:
+  args:     2 11
+  intput:
+  output:   22
+- setup:
+  cleanup:
+  args:     2 23
+  intput:
+  output:   46
+- setup:
+  cleanup:
+  args:     2 37
+  intput:
+  output:   74
+- setup:
+  cleanup:
+  args:     2 47
+  intput:
+  output:   94
+- setup:
+  cleanup:
+  args:     3 3
+  intput:
+  output:   9
+- setup:
+  cleanup:
+  args:     3 5
+  intput:
+  output:   15
+- setup:
+  cleanup:
+  args:     3 7
+  intput:
+  output:   21
+- setup:
+  cleanup:
+  args:     3 11
+  intput:
+  output:   33
+- setup:
+  cleanup:
+  args:     3 23
+  intput:
+  output:   69
+- setup:
+  cleanup:
+  args:     3 37
+  intput:
+  output:   111
+- setup:
+  cleanup:
+  args:     3 47
+  intput:
+  output:   141
+- setup:
+  cleanup:
+  args:     5 5
+  intput:
+  output:   25
+- setup:
+  cleanup:
+  args:     5 7
+  intput:
+  output:   35
+- setup:
+  cleanup:
+  args:     5 11
+  intput:
+  output:   55
+- setup:
+  cleanup:
+  args:     5 23
+  intput:
+  output:   115
+- setup:
+  cleanup:
+  args:     5 37
+  intput:
+  output:   185
+- setup:
+  cleanup:
+  args:     5 47
+  intput:
+  output:   235
+- setup:
+  cleanup:
+  args:     7 7
+  intput:
+  output:   49
+- setup:
+  cleanup:
+  args:     7 11
+  intput:
+  output:   77
+- setup:
+  cleanup:
+  args:     7 23
+  intput:
+  output:   161
+- setup:
+  cleanup:
+  args:     7 37
+  intput:
+  output:   259
+- setup:
+  cleanup:
+  args:     7 47
+  intput:
+  output:   329
+- setup:
+  cleanup:
+  args:     11 11
+  intput:
+  output:   121
+- setup:
+  cleanup:
+  args:     11 23
+  intput:
+  output:   253
+- setup:
+  cleanup:
+  args:     11 37
+  intput:
+  output:   407
+- setup:
+  cleanup:
+  args:     11 47
+  intput:
+  output:   517
+- setup:
+  cleanup:
+  args:     23 23
+  intput:
+  output:   529
+- setup:
+  cleanup:
+  args:     23 37
+  intput:
+  output:   851
+- setup:
+  cleanup:
+  args:     23 47
+  intput:
+  output:   1081
+- setup:
+  cleanup:
+  args:     37 37
+  intput:
+  output:   1369
+- setup:
+  cleanup:
+  args:     37 47
+  intput:
+  output:   1739
+- setup:
+  cleanup:
+  args:     47 47
+  intput:
+  output:   2209
diff --git a/challenge-090/paulo-custodio/test.pl b/challenge-090/paulo-custodio/test.pl
index 8e24f40f17..01ed2b83cd 100644
--- a/challenge-090/paulo-custodio/test.pl
+++ b/challenge-090/paulo-custodio/test.pl
@@ -2,30 +2,6 @@
 
 use strict;
 use warnings;
-use Test::More;
+use 5.030;
 
-# task 1
-
-my $adn = "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG";
-my $cpl = "CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC";
-my $len = length($adn);
-
-is `gforth forth/ch-1.fs $adn`, "$len \n$cpl\n";
-is `gforth forth/ch-1.fs $cpl`, "$len \n$adn\n";
-
-is `perl perl/ch-1.pl $adn`, "$len\n$cpl\n";
-is `perl perl/ch-1.pl $cpl`, "$len\n$adn\n";
-
-
-# task 2
-
-for my $a (0,1,2,3,4,5,14) {
-    for my $b (0,1,2,3,4,5,12) {
-        my $r = $a*$b;
-        is `gforth -e ' $a $b' forth/ch-2.fs`, "$r \n";
-
-        is `perl perl/ch-2.pl $a $b`, "$r\n";
-    }
-}
-
-done_testing;
+require '../../challenge-001/paulo-custodio/test.pl';