Merge pull request #2965 from somethingweird/C90

C90

2 files changed, 60 insertions, 0 deletions

diff --git a/challenge-090/henry-wong/php/ch-1.php b/challenge-090/henry-wong/php/ch-1.php
new file mode 100644
index 0000000000..f0f481e573
--- /dev/null
+++ b/challenge-090/henry-wong/php/ch-1.php
@@ -0,0 +1,31 @@
+<?php
+/**
+ * DNA is a long, chainlike molecule which has two strands twisted into a double helix. 
+ * The two strands are made up of simpler molecules called nucleotides. 
+ * Each nucleotide is composed of one of the four nitrogen-containing nucleobases 
+ * 
+ * cytosine (C), 
+ * guanine (G), 
+ * adenine (A) and thymine (T).
+ * 
+ * You are given DNA sequence, 
+ * GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG
+ * 
+ * Write a script to print nucleiobase count in the given DNA sequence. 
+ * Also print the complementary sequence where Thymine (T) on one strand is 
+ * always facing an adenine (A) and vice versa; guanine (G) 
+ * is always facing a cytosine (C) and vice versa. 
+ */
+
+ function nucleiobase_count($DNA) {
+    return array_count_values(str_split($DNA));
+
+ }
+
+ function complementary($DNA) {
+    return strtr($DNA, 'TAGC', 'ATCG');
+ }
+
+$test_dna = 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+print_r(nucleiobase_count($test_dna));
+echo complementary($test_dna), "\n";
\ No newline at end of file
diff --git a/challenge-090/henry-wong/php/ch-2.php b/challenge-090/henry-wong/php/ch-2.php
new file mode 100644
index 0000000000..b3ec7750f5
--- /dev/null
+++ b/challenge-090/henry-wong/php/ch-2.php
@@ -0,0 +1,29 @@
+<?php
+
+/**
+ * You are given two positive numbers $A and $B.
+ * Write a script to demonstrate Ethiopian Multiplication using the given numbers.
+ * - see https://threesixty360.wordpress.com/2009/06/09/ethiopian-multiplication/
+ * 
+ * Example: 10 x 20
+ * 10 20 - dont keep because 10 is even
+ * 5  40 - we keep 40, - because 5 is odd
+ * 2  80 - we dont keep because of 2 is even
+ * 1  160 - we keep
+ * 
+ * 40+160 = 200;
+ */
+
+function ethiopian_muliply($A, $B) {
+    $total = 0;
+    while ($A >= 1) {
+        if ($A % 2 == 1) {
+            $total += $B;
+        }
+        $A = floor($A / 2 );
+        $B = $B * 2;
+    };
+    return $total;
+}
+
+echo ethiopian_muliply(10, 20);
\ No newline at end of file