imported my solutions to this week's tasks

3 files changed, 128 insertions, 29 deletions

diff --git a/challenge-090/duncan-c-white/README b/challenge-090/duncan-c-white/README
index a5b283e113..91b90f56ac 100644
--- a/challenge-090/duncan-c-white/README
+++ b/challenge-090/duncan-c-white/README
@@ -1,44 +1,40 @@
-Task 1: "GCD Sum
+Task 1: "DNA Sequence
 
-You are given a positive integer $N.
-Write a script to sum GCD of all possible unique pairs between 1 and $N.
+DNA is a long, chainlike molecule which has two strands twisted into
+a double helix. The two strands are made up of simpler molecules
+called nucleotides. Each nucleotide is composed of one of the four
+nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A)
+and thymine (T).
 
-Example 1:
+You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
 
-	Input: 3
-	Output: 3
+Write a script to print nucleobase count in the given DNA sequence. Also
+print the complementary sequence where Thymine (T) on one strand is
+always facing an adenine (A) and vice versa; guanine (G) is always facing
+a cytosine (C) and vice versa.
 
-	gcd(1,2) + gcd(1,3) + gcd(2,3)
+To get the complementary sequence use the following mapping:
 
-Example 2:
-
-	Input: 4
-	Output: 7
-
-	gcd(1,2) + gcd(1,3) + gcd(1,4) + gcd(2,3) + gcd(2,4) + gcd(3,4)
+T => A
+A => T
+G => C
+C => G
 "
 
-My notes: very clearly defined.  Haven't used GCDs for a while:-)
+My notes: very clearly defined, simple to do.
 
 
-Task 2: "Magical Matrix
+Task 2: "Ethiopian Multiplication
 
-Write a script to display matrix as below with numbers 1 - 9. Please make sure numbers are used once.
+You are given two positive numbers $A and $B.
 
-[ a b c ]
-[ d e f ]
-[ g h i ]
+Write a script to demonstrate 
 
-So that it satisfies the following:
+https://rosettacode.org/wiki/Ethiopian_multiplication
 
-a + b + c = 15
-d + e + f = 15
-g + h + i = 15
-a + d + g = 15
-b + e + h = 15
-c + f + i = 15
-a + e + i = 15
-c + e + g = 15
+using the given numbers.
 "
 
-My notes: clearly defined.  Constraint problem.
+My notes: clearly defined, once you follow the link and discover what Ethiopian Multiplication is:-)
+Exercise for the interested reader: why does the method work?  It follows directly from how BINARY
+multiplication actually works.
diff --git a/challenge-090/duncan-c-white/perl/ch-1.pl b/challenge-090/duncan-c-white/perl/ch-1.pl
new file mode 100755
index 0000000000..ea0fb6e625
--- /dev/null
+++ b/challenge-090/duncan-c-white/perl/ch-1.pl
@@ -0,0 +1,53 @@
+#!/usr/bin/perl
+#
+# Task 1: "DNA Sequence
+# 
+# DNA is a long, chainlike molecule which has two strands twisted into
+# a double helix. The two strands are made up of simpler molecules
+# called nucleotides. Each nucleotide is composed of one of the four
+# nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A)
+# and thymine (T).
+# 
+# You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+# 
+# Write a script to print nucleobase count in the given DNA sequence. Also
+# print the complementary sequence where Thymine (T) on one strand is
+# always facing an adenine (A) and vice versa; guanine (G) is always facing
+# a cytosine (C) and vice versa.
+# 
+# To get the complementary sequence use the following mapping:
+# 
+# T => A
+# A => T
+# G => C
+# C => G
+# "
+# 
+# My notes: very clearly defined, simple to do.
+# 
+
+use strict;
+use warnings;
+use feature 'say';
+use Getopt::Long;
+use Data::Dumper;
+
+my $debug = 0;
+die "Usage: dna [--debug] sequence\n" unless
+	GetOptions( "debug" => \$debug ) &&
+	@ARGV==1;
+my $seq = shift;
+
+my %freq;
+my $comp = "";
+my %comp = qw(T A A T G C C G);
+@freq{keys %comp} = (0) x (keys %comp);
+
+$seq =~ tr/ATCG//cd;
+foreach my $base (split(//,$seq))
+{
+	$freq{$base}++;
+	$comp .= $comp{$base};
+}
+say "complement: $comp";
+say "freq{$_} = $freq{$_}" for sort keys %comp;
diff --git a/challenge-090/duncan-c-white/perl/ch-2.pl b/challenge-090/duncan-c-white/perl/ch-2.pl
new file mode 100755
index 0000000000..8cabeac23f
--- /dev/null
+++ b/challenge-090/duncan-c-white/perl/ch-2.pl
@@ -0,0 +1,50 @@
+#!/usr/bin/perl
+#
+# Task 2: "Ethiopian Multiplication
+# 
+# You are given two positive numbers $A and $B.
+# 
+# Write a script to demonstrate
+#   https://rosettacode.org/wiki/Ethiopian_multiplication
+# using the given numbers.
+# "
+# 
+# My notes: clearly defined, once you follow the link and discover what Ethiopian Multiplication is:-)
+# Exercise for the interested reader: why does the method work?  It follows directly from how BINARY
+# multiplication actually works.
+#
+
+use strict;
+use warnings;
+use Data::Dumper;
+use Function::Parameters;
+use feature 'say';
+use Getopt::Long;
+
+my $debug = 0;
+die "Usage: ethiopian-multiplication [--debug] A B\n" unless
+	GetOptions( "debug" => \$debug ) &&
+	@ARGV==2;
+my( $a, $b ) = @ARGV;
+
+say ethiopian( $a, $b );
+
+
+#
+# my $m = ethiopian( $a, $b );
+#	Use Ethiopian Multiplication - the original Egyptian/Ethiopian/Russian
+#	form of multiplication using repeated doublings and halvings.
+#
+fun ethiopian( $a, $b )
+{
+	my $r = 0;
+	while( $a >= 1 )
+	{
+		say "r:$r, a:$a, b:$b" if $debug;
+		$r += $b if $a % 2 == 1;
+		$a /= 2; $a = int($a);
+		$b *= 2;
+	}
+	say "r:$r, a:$a, b:$b" if $debug;
+	return $r;
+}