Regenerate programs from org tangle

2 files changed, 6 insertions, 39 deletions

diff --git a/challenge-090/wlmb/perl/ch-1.pl b/challenge-090/wlmb/perl/ch-1.pl
index 00e54fa1e0..9e5f5c07c4 100755
--- a/challenge-090/wlmb/perl/ch-1.pl
+++ b/challenge-090/wlmb/perl/ch-1.pl
@@ -1,13 +1,12 @@
 #!/usr/bin/env perl
 # For sequences of DNA get nucleotide counts and its complement
-
+# See https:/wlmb.github.io/2020/12/07/PWC90/#task-1-dna-sequence
 use strict;
 use warnings;
 use v5.10;
 
 use List::Util qw(sum0);
 
-# Receive sequences as strings in @ARGV
 say('Usage: ch-1.pl sequence1 sequence2 ...'), exit 1 unless @ARGV;
 
 my %complement_of; # Map dna nucleotide to its complement
@@ -32,33 +31,7 @@ sub get_count_for { # count nucleotides of a dna sequence
     my $sequence=shift;
     my @nucleotides=split //,$sequence;
     my %count_for; # counts of nucleotides
-    @count_for{split //, "TAGC"}=((0) x 4); #initialize with 0's
+    @count_for{qw(T A G C)}=((0) x 4); #initialize with 0's
     map {$count_for{$_}++} split //, $sequence;
     return %count_for;
 }
-
-# Sample run:
-#
-# $ ./ch-1.pl hithere \
-# GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG \
-# TGCTGGTCGCCG
-#
-# yields:
-#
-# Wrong sequence HITHERE
-#   Sequence: GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG
-# Complement: CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC
-# Nucleotide counts:
-#         T-A 22
-#         A-T 14
-#         G-C 13
-#         C-G 18
-#         Total   67
-#   Sequence: TGCTGGTCGCCG
-# Complement: ACGACCAGCGGC
-# Nucleotide counts:
-#         T-A 3
-#         A-T 0
-#         G-C 5
-#         C-G 4
-#         Total   12
diff --git a/challenge-090/wlmb/perl/ch-2.pl b/challenge-090/wlmb/perl/ch-2.pl
index 6be0c0de39..781624d2d9 100755
--- a/challenge-090/wlmb/perl/ch-2.pl
+++ b/challenge-090/wlmb/perl/ch-2.pl
@@ -1,6 +1,6 @@
 #!/usr/bin/env perl
 # Multiply two numbers using the Ethiopian Multiplication
-
+# See https:/wlmb.github.io/2020/12/07/PWC90/#task-2-ethiopian-multiplication
 use strict;
 use warnings;
 use v5.10;
@@ -12,10 +12,12 @@ die 'Usage: ./ch2.pl number1 number2' unless @ARGV==2;
 my ($x, $y)=@ARGV;
 die 'Expected two non-negative integers'   # check signs
     unless all {int($_)==$_ && $_>=0} ($x, $y);
+
 my $expected_result=$x*$y;
 my $result=0;
 my $result_string="$x x $y = ";
 my $operator="";
+
 while($x){
     if($x&1){  # $x is odd, add $y to result
 	print "->"; # flag line
@@ -24,17 +26,9 @@ while($x){
     } else {   # $x is even, don't add y
 	$result_string.="$operator 0 x $y";
     }
-    say "\t$x\t$y";
+    say "\tx=$x\ty=$y";
     $operator=" + ";
     $x>>=1;  # Divde $x by 2
     $y<<=1;  # Multiply $y by 2
 }
 say " $result_string = $result (Expected: $expected_result)";
-
-# Sample run:
-# $ ./ch-2.pl 11 23
-# ->      11      23
-# ->      5       46
-#         2       92
-# ->      1       184
-#  11 x 23 =  1 x 23 +  1 x 46 +  0 x 92 +  1 x 184 = 253 (Expected: 253)