diff options
| author | Luis Mochan <mochan@fis.unam.mx> | 2020-12-09 11:40:28 -0600 |
|---|---|---|
| committer | Luis Mochan <mochan@fis.unam.mx> | 2020-12-09 11:40:28 -0600 |
| commit | a2734b4cbec67d4ebd50ce18256820999927e9b1 (patch) | |
| tree | b1a3bf808036b976e1be8b595edab69b915d2b9d | |
| parent | d44f0879d277582380b3aef003dcd65fe1bd6e6a (diff) | |
| download | perlweeklychallenge-club-a2734b4cbec67d4ebd50ce18256820999927e9b1.tar.gz perlweeklychallenge-club-a2734b4cbec67d4ebd50ce18256820999927e9b1.tar.bz2 perlweeklychallenge-club-a2734b4cbec67d4ebd50ce18256820999927e9b1.zip | |
Regenerate programs from org tangle
| -rwxr-xr-x | challenge-090/wlmb/perl/ch-1.pl | 31 | ||||
| -rwxr-xr-x | challenge-090/wlmb/perl/ch-2.pl | 14 |
2 files changed, 6 insertions, 39 deletions
diff --git a/challenge-090/wlmb/perl/ch-1.pl b/challenge-090/wlmb/perl/ch-1.pl index 00e54fa1e0..9e5f5c07c4 100755 --- a/challenge-090/wlmb/perl/ch-1.pl +++ b/challenge-090/wlmb/perl/ch-1.pl @@ -1,13 +1,12 @@ #!/usr/bin/env perl # For sequences of DNA get nucleotide counts and its complement - +# See https:/wlmb.github.io/2020/12/07/PWC90/#task-1-dna-sequence use strict; use warnings; use v5.10; use List::Util qw(sum0); -# Receive sequences as strings in @ARGV say('Usage: ch-1.pl sequence1 sequence2 ...'), exit 1 unless @ARGV; my %complement_of; # Map dna nucleotide to its complement @@ -32,33 +31,7 @@ sub get_count_for { # count nucleotides of a dna sequence my $sequence=shift; my @nucleotides=split //,$sequence; my %count_for; # counts of nucleotides - @count_for{split //, "TAGC"}=((0) x 4); #initialize with 0's + @count_for{qw(T A G C)}=((0) x 4); #initialize with 0's map {$count_for{$_}++} split //, $sequence; return %count_for; } - -# Sample run: -# -# $ ./ch-1.pl hithere \ -# GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG \ -# TGCTGGTCGCCG -# -# yields: -# -# Wrong sequence HITHERE -# Sequence: GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG -# Complement: CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC -# Nucleotide counts: -# T-A 22 -# A-T 14 -# G-C 13 -# C-G 18 -# Total 67 -# Sequence: TGCTGGTCGCCG -# Complement: ACGACCAGCGGC -# Nucleotide counts: -# T-A 3 -# A-T 0 -# G-C 5 -# C-G 4 -# Total 12 diff --git a/challenge-090/wlmb/perl/ch-2.pl b/challenge-090/wlmb/perl/ch-2.pl index 6be0c0de39..781624d2d9 100755 --- a/challenge-090/wlmb/perl/ch-2.pl +++ b/challenge-090/wlmb/perl/ch-2.pl @@ -1,6 +1,6 @@ #!/usr/bin/env perl # Multiply two numbers using the Ethiopian Multiplication - +# See https:/wlmb.github.io/2020/12/07/PWC90/#task-2-ethiopian-multiplication use strict; use warnings; use v5.10; @@ -12,10 +12,12 @@ die 'Usage: ./ch2.pl number1 number2' unless @ARGV==2; my ($x, $y)=@ARGV; die 'Expected two non-negative integers' # check signs unless all {int($_)==$_ && $_>=0} ($x, $y); + my $expected_result=$x*$y; my $result=0; my $result_string="$x x $y = "; my $operator=""; + while($x){ if($x&1){ # $x is odd, add $y to result print "->"; # flag line @@ -24,17 +26,9 @@ while($x){ } else { # $x is even, don't add y $result_string.="$operator 0 x $y"; } - say "\t$x\t$y"; + say "\tx=$x\ty=$y"; $operator=" + "; $x>>=1; # Divde $x by 2 $y<<=1; # Multiply $y by 2 } say " $result_string = $result (Expected: $expected_result)"; - -# Sample run: -# $ ./ch-2.pl 11 23 -# -> 11 23 -# -> 5 46 -# 2 92 -# -> 1 184 -# 11 x 23 = 1 x 23 + 1 x 46 + 0 x 92 + 1 x 184 = 253 (Expected: 253) |
