Merge branch 'master' of https://github.com/manwar/perlweeklychallenge-club

2 files changed, 84 insertions, 0 deletions

diff --git a/challenge-090/wanderdoc/perl/ch-1.pl b/challenge-090/wanderdoc/perl/ch-1.pl
new file mode 100644
index 0000000000..ca0ae57c9e
--- /dev/null
+++ b/challenge-090/wanderdoc/perl/ch-1.pl
@@ -0,0 +1,29 @@
+#!perl
+use strict;
+use warnings FATAL => qw(all);
+
+=prompt
+You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+Write a script to print nucleiobase count in the given DNA sequence. Also print the complementary sequence.
+=cut
+
+
+
+
+
+
+
+
+
+
+my $strand_1 = 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+my %compl = (T => 'A', A => 'T', G => 'C', C => 'G');
+
+my %count;
+my $strand_2 = join('', map { $count{$_}++; $compl{$_}} split(//, $strand_1));
+
+print "$_ => $count{$_}$/" for sort { $a cmp $b } keys %count;
+
+print $strand_1, $/;
+print '|' x length($strand_1), $/;
+print $strand_2, $/;
\ No newline at end of file
diff --git a/challenge-090/wanderdoc/perl/ch-2.pl b/challenge-090/wanderdoc/perl/ch-2.pl
new file mode 100644
index 0000000000..1aca7425b9
--- /dev/null
+++ b/challenge-090/wanderdoc/perl/ch-2.pl
@@ -0,0 +1,55 @@
+#!perl
+use strict;
+use warnings FATAL => qw(all);
+
+=prompt
+You are given two positive numbers $A and $B.
+Write a script to demonstrate Ethiopian Multiplication using the given numbers.
+https://threesixty360.wordpress.com/2009/06/09/ethiopian-multiplication/
+=cut
+
+
+
+
+
+
+
+
+
+use Test::More;
+use Scalar::Util qw(looks_like_number);
+
+sub em
+{
+
+     my ($num_1, $num_2) = @_;
+
+     die "Two positive integers required!$/" 
+          unless (looks_like_number($num_1) and looks_like_number($num_2) and
+          $num_1 > 0 and $num_2 > 0 and 
+          $num_1 = int($num_1) and $num_2 = int($num_2));
+     return 0 if ($num_1 == 0 or $num_2 == 0);
+     my $sum;
+     while ( $num_1 > 0 )
+     {
+          if ( $num_1 % 2 )
+          {
+               $sum += $num_2;
+          }
+
+
+          $num_1 = int($num_1/2);
+          $num_2 *= 2;
+     }
+
+     return $sum;
+}
+
+
+
+is(em(14, 12), 14 * 12, 'Example 1');
+is(em(25,  5), 25 *  5, 'Example 2');
+is(em(15, 30), 15 * 30, 'Example 3');
+
+
+done_testing;
\ No newline at end of file