diff options
| author | Flavio Poletti <flavio@polettix.it> | 2020-12-07 12:07:06 +0100 |
|---|---|---|
| committer | Flavio Poletti <flavio@polettix.it> | 2020-12-07 12:07:06 +0100 |
| commit | e3146b46c4c52faff040f039d2fa7fe7e5373e92 (patch) | |
| tree | e64081154ba17b9ac575b076828d6c7e73d7be32 | |
| parent | d181a79cc3b10b862de348d6a6ca503df28e5203 (diff) | |
| download | perlweeklychallenge-club-e3146b46c4c52faff040f039d2fa7fe7e5373e92.tar.gz perlweeklychallenge-club-e3146b46c4c52faff040f039d2fa7fe7e5373e92.tar.bz2 perlweeklychallenge-club-e3146b46c4c52faff040f039d2fa7fe7e5373e92.zip | |
Add polettix's solution to PWC090
| -rw-r--r-- | challenge-090/polettix/blog.txt | 1 | ||||
| -rw-r--r-- | challenge-090/polettix/blog1.txt | 1 | ||||
| -rw-r--r-- | challenge-090/polettix/perl/ch-1.pl | 21 | ||||
| -rw-r--r-- | challenge-090/polettix/perl/ch-2.pl | 53 |
4 files changed, 76 insertions, 0 deletions
diff --git a/challenge-090/polettix/blog.txt b/challenge-090/polettix/blog.txt new file mode 100644 index 0000000000..9a045abf89 --- /dev/null +++ b/challenge-090/polettix/blog.txt @@ -0,0 +1 @@ +https://github.polettix.it/ETOOBUSY/2020/12/11/pwc090-dna-sequence/ diff --git a/challenge-090/polettix/blog1.txt b/challenge-090/polettix/blog1.txt new file mode 100644 index 0000000000..862e8fd3ab --- /dev/null +++ b/challenge-090/polettix/blog1.txt @@ -0,0 +1 @@ +https://github.polettix.it/ETOOBUSY/2020/12/12/pwc090-ethiopian-multiplication/ diff --git a/challenge-090/polettix/perl/ch-1.pl b/challenge-090/polettix/perl/ch-1.pl new file mode 100644 index 0000000000..d1d9d41769 --- /dev/null +++ b/challenge-090/polettix/perl/ch-1.pl @@ -0,0 +1,21 @@ +#!/usr/bin/env perl +use 5.024; +use warnings; +use experimental qw< postderef signatures >; +no warnings qw< experimental::postderef experimental::signatures >; + +sub dna_sequence ($s) { + my $complementary = $s =~ tr{ACGT}{TGCA}r; + my %cf = map { $_ => eval "scalar \$s =~ tr{$_}{}d" } qw< A C G T >; + return (\%cf, $complementary); +} + +my $default = + 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG'; +my $sequence = shift || $default; +my ($cf, $complementary) = dna_sequence($sequence); + +$|++; +say {*STDERR} $sequence; +say {*STDOUT} $complementary; +say {*STDOUT} "A<$cf->{A}> C<$cf->{C}> G<$cf->{G}> T<$cf->{T}>"; diff --git a/challenge-090/polettix/perl/ch-2.pl b/challenge-090/polettix/perl/ch-2.pl new file mode 100644 index 0000000000..2ef03d7cd5 --- /dev/null +++ b/challenge-090/polettix/perl/ch-2.pl @@ -0,0 +1,53 @@ +#!/usr/bin/env perl +use 5.024; +use warnings; +use experimental qw< postderef signatures >; +no warnings qw< experimental::postderef experimental::signatures >; + +sub ethiopian_multiplication ($A, $B) { + say {*STDOUT} "# Let's multiply A = $A and B = $B, the Ethiopian way!"; + + my $p = sub { printf {*STDOUT} "A = %3d, B = %3d%s\n", $A, $B, ($A % 2 ? ' (*)' : '') }; + $p->(); + say {*STDOUT} ''; + + my $result_string = "A * B = $A * $B"; + + if ($A == 1 || $B == 1) { + say {*STDOUT} "$result_string = ", $A * $B, ' no need for Ethiopians!'; + return; + } + + my $A_starts_even = $A % 2 == 0; + if ($A_starts_even) { + say {*STDOUT} '# Let\'s transfer all the even-ness from A to B'; + while ($A % 2 == 0) { + $A /= 2; + $B *= 2; + $p->(); + } + say {*STDOUT} ''; + } + + my $sum = $B; + if ($A > 1) { + print {*STDOUT} $A_starts_even ? '# Now ' : '# '; + say {*STDOUT} 'A is odd, but we will ignore remainders for now...'; + while ($A > 1) { + $A = int($A / 2); + $B *= 2; + $sum += $B; + $p->(); + } + say {*STDOUT} ''; + } + + say {*STDOUT} '# Now, we take all "B" values marked with an asterisk'; + say {*STDOUT} "$result_string = $sum"; + + return; +} + +my $A = shift || 14; +my $B = shift || 12; +ethiopian_multiplication($A, $B); |
