diff options
| author | Mohammad S Anwar <Mohammad.Anwar@yahoo.com> | 2020-12-14 01:04:05 +0000 |
|---|---|---|
| committer | GitHub <noreply@github.com> | 2020-12-14 01:04:05 +0000 |
| commit | f9e7ae3c41232cfc91a1afff2e9cc2f59f032175 (patch) | |
| tree | 93407537f3cbb29c27c72d711689895b4bb6f330 | |
| parent | a3c48d7f4dfbaf7378cc429aff2933286bc9f6d9 (diff) | |
| parent | 9574d750f4be19fd25966be9ad881e14b8d8174c (diff) | |
| download | perlweeklychallenge-club-f9e7ae3c41232cfc91a1afff2e9cc2f59f032175.tar.gz perlweeklychallenge-club-f9e7ae3c41232cfc91a1afff2e9cc2f59f032175.tar.bz2 perlweeklychallenge-club-f9e7ae3c41232cfc91a1afff2e9cc2f59f032175.zip | |
Merge pull request #2981 from adamcrussell/challenge-090
Challenge 090
| -rw-r--r-- | challenge-090/adam-russell/blog.txt | 1 | ||||
| -rw-r--r-- | challenge-090/adam-russell/perl/ch-1.pl | 27 | ||||
| -rw-r--r-- | challenge-090/adam-russell/perl/ch-2.pl | 27 |
3 files changed, 55 insertions, 0 deletions
diff --git a/challenge-090/adam-russell/blog.txt b/challenge-090/adam-russell/blog.txt new file mode 100644 index 0000000000..f29baaf0b9 --- /dev/null +++ b/challenge-090/adam-russell/blog.txt @@ -0,0 +1 @@ +www.rabbitfarm.com/cgi-bin/blosxom/perl/2020/12/13 diff --git a/challenge-090/adam-russell/perl/ch-1.pl b/challenge-090/adam-russell/perl/ch-1.pl new file mode 100644 index 0000000000..382f19295f --- /dev/null +++ b/challenge-090/adam-russell/perl/ch-1.pl @@ -0,0 +1,27 @@ +use strict; +use warnings; +## +# Write a script to print the nucleiobase count in +# the given DNA sequence. Also print the complementary +# sequence where Thymine (T) on one strand is always +# facing an adenine (A) and vice versa; guanine (G) is +# always facing a cytosine (C) and vice versa. +## +use constant SEQUENCE => "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG"; +my %nucleotide_map = ( + "T" => "A", + "A" => "T", + "G" => "C", + "C" => "G" +); + +sub complementary_sequence{ + my($sequence) = @_; + my @complement = map { $nucleotide_map{$_} } split(//, $sequence); + return @complement; +} + +MAIN:{ + print "length of sequence: " . length(SEQUENCE) . "\n"; + print "complementary sequence: " . join("", complementary_sequence(SEQUENCE)) . "\n"; +} diff --git a/challenge-090/adam-russell/perl/ch-2.pl b/challenge-090/adam-russell/perl/ch-2.pl new file mode 100644 index 0000000000..2654c6476f --- /dev/null +++ b/challenge-090/adam-russell/perl/ch-2.pl @@ -0,0 +1,27 @@ +use strict; +use warnings; +## +# You are given two positive numbers $A and $B. +# Write a script to demonstrate Ethiopian Multiplication +# using the given numbers. +## +sub ethiopian_multiplication{ + my($a, $b) = @_; + my @steps; + my $product = 0; + my ($x, $y) = ($a, $b); + do{ + $x = int($x / 2); + $y = $y * 2; + push @steps, [$x, $y] if $x % 2 != 0; + }until $steps[-1]->[0] == 1; + for my $step (@steps){ + $product += $step->[1]; + } + return $product; +} + +MAIN:{ + my($A, $B) = (14, 12); + print "$A x $B = " . ethiopian_multiplication($A, $B) . "\n"; +} |
