Merge remote-tracking branch 'upstream/master'

2 files changed, 60 insertions, 0 deletions

diff --git a/challenge-090/paulo-custodio/lua/ch-1.lua b/challenge-090/paulo-custodio/lua/ch-1.lua
new file mode 100644
index 0000000000..8126c4a171
--- /dev/null
+++ b/challenge-090/paulo-custodio/lua/ch-1.lua
@@ -0,0 +1,32 @@
+#!/usr/bin/env lua
+
+--[[
+Challenge 090
+
+TASK #1 > DNA Sequence
+Submitted by: Mohammad S Anwar
+DNA is a long, chainlike molecule which has two strands twisted into a
+double helix. The two strands are made up of simpler molecules called
+nucleotides. Each nucleotide is composed of one of the four nitrogen-containing
+nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).
+
+You are given DNA sequence,
+GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+
+Write a script to print nucleiobase count in the given DNA sequence.
+Also print the complementary sequence where Thymine (T) on one strand
+is always facing an adenine (A) and vice versa; guanine (G) is always
+facing a cytosine (C) and vice versa.
+--]]
+
+function complement(seq)
+    local trans = {T = "A", A = "T", G = "C", C = "G"}
+    local compl = string.gsub(seq, "[TAGC]", trans)
+    return compl
+end
+
+seq = arg[1]
+compl = complement(seq)
+
+io.write(#seq, "\n")
+io.write(compl)
diff --git a/challenge-090/paulo-custodio/lua/ch-2.lua b/challenge-090/paulo-custodio/lua/ch-2.lua
new file mode 100644
index 0000000000..d9e54b052f
--- /dev/null
+++ b/challenge-090/paulo-custodio/lua/ch-2.lua
@@ -0,0 +1,28 @@
+#!/usr/bin/env lua
+
+--[[
+Challenge 090
+
+TASK #2 > Ethiopian Multiplication
+Submitted by: Mohammad S Anwar
+You are given two positive numbers $a and $b.
+
+Write a script to demonstrate Ethiopian Multiplication using the given numbers.
+--]]
+
+function mul(a, b)
+    local m = 0
+    while (true) do
+        if ((a & 1) ~= 0) then
+            m = m + b
+        end
+        if (a <= 1) then
+            break
+        end
+        a = a >> 1
+        b = b << 1
+    end
+    return m
+end
+
+io.write(mul(tonumber(arg[1]), tonumber(arg[2])), "\n")