Merge branch 'master' of github.com:manwar/perlweeklychallenge-club

7 files changed, 93 insertions, 29 deletions

diff --git a/challenge-090/tyler-wardhaugh/clojure/README.md b/challenge-090/tyler-wardhaugh/clojure/README.md
index f5a89af18d..41000b8199 100644
--- a/challenge-090/tyler-wardhaugh/clojure/README.md
+++ b/challenge-090/tyler-wardhaugh/clojure/README.md
@@ -1,13 +1,13 @@
-# tw.weekly.c89
+# tw.weekly.c90
 
 
-The Weekly Challenge - #089 - Tyler Wardhaugh
+The Weekly Challenge - #090 - Tyler Wardhaugh
 
 ## Usage
 
 Run the project directly (shows default output from both tasks):
 
-    $ clojure -M -m tw.weekly.c89.core
+    $ clojure -M -m tw.weekly.c90.core
 
 Run the project's tests (which are samples from the task descriptions):
 
@@ -15,11 +15,11 @@ Run the project's tests (which are samples from the task descriptions):
 
 Run Task #1 with input
 
-    $ clojure -M -m tw.weekly.c89.t1 N
+    $ clojure -M -m tw.weekly.c90.t1 DNA
 
 Run Task #2:
 
-    $ clojure -M -m tw.weekly.c89.t2
+    $ clojure -M -m tw.weekly.c90.t2 A B
 
 ## Project Template
 
diff --git a/challenge-090/tyler-wardhaugh/clojure/deps.edn b/challenge-090/tyler-wardhaugh/clojure/deps.edn
index cfd5d782d1..1fae9ef933 100644
--- a/challenge-090/tyler-wardhaugh/clojure/deps.edn
+++ b/challenge-090/tyler-wardhaugh/clojure/deps.edn
@@ -1,9 +1,5 @@
 {:paths ["src" "resources"]
- :deps {org.clojure/clojure {:mvn/version "1.10.1"}
-        org.clojure/core.logic {:mvn/version "1.0.0"}
-        org.clojure/math.combinatorics {:mvn/version "0.1.6"}
-        org.clojure/math.numeric-tower {:mvn/version "0.0.4"}
-        org.clojure/tools.macro {:mvn/version "0.1.2"}}
+ :deps {org.clojure/clojure {:mvn/version "1.10.1"}}
  :aliases
  {:test {:extra-paths ["test"]
          :extra-deps {org.clojure/test.check {:mvn/version "1.0.0"}}}
@@ -14,5 +10,5 @@
    :main-opts ["-m" "cognitect.test-runner"
                "-d" "test"]}
   :uberjar {:extra-deps {seancorfield/depstar {:mvn/version "1.0.94"}}
-            :main-opts ["-m" "hf.depstar.uberjar" "tw.weekly.c88.jar"
-                        "-C" "-m" "tw.weekly.c88"]}}}
+            :main-opts ["-m" "hf.depstar.uberjar" "tw.weekly.c90.jar"
+                        "-C" "-m" "tw.weekly.c90"]}}}
diff --git a/challenge-090/tyler-wardhaugh/clojure/pom.xml b/challenge-090/tyler-wardhaugh/clojure/pom.xml
index 3097f51f8e..bc8a82e4cd 100644
--- a/challenge-090/tyler-wardhaugh/clojure/pom.xml
+++ b/challenge-090/tyler-wardhaugh/clojure/pom.xml
@@ -2,11 +2,11 @@
 <project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd">
   <modelVersion>4.0.0</modelVersion>
   <groupId>tw.weekly</groupId>
-  <artifactId>tw.weekly.c89</artifactId>
+  <artifactId>tw.weekly.c90</artifactId>
   <version>0.1.0-SNAPSHOT</version>
-  <name>tw.weekly.c89</name>
-  <description>Challenge #089</description>
-  <url>https://github.com/tw.weekly/tw.weekly.c89</url>
+  <name>tw.weekly.c90</name>
+  <description>Challenge #090</description>
+  <url>https://github.com/tw.weekly/tw.weekly.c90</url>
   <licenses>
     <license>
       <name>Eclipse Public License</name>
@@ -19,9 +19,9 @@
     </developer>
   </developers>
   <scm>
-    <url>https://github.com/tw.weekly/tw.weekly.c89</url>
-    <connection>scm:git:git://github.com/tw.weekly/tw.weekly.c89.git</connection>
-    <developerConnection>scm:git:ssh://git@github.com/tw.weekly/tw.weekly.c89.git</developerConnection>
+    <url>https://github.com/tw.weekly/tw.weekly.c90</url>
+    <connection>scm:git:git://github.com/tw.weekly/tw.weekly.c90.git</connection>
+    <developerConnection>scm:git:ssh://git@github.com/tw.weekly/tw.weekly.c90.git</developerConnection>
     <tag>HEAD</tag>
   </scm>
   <dependencies>
@@ -30,16 +30,6 @@
       <artifactId>clojure</artifactId>
       <version>1.10.1</version>
     </dependency>
-    <dependency>
-      <groupId>net.mikera</groupId>
-      <artifactId>core.matrix</artifactId>
-      <version>0.62.0</version>
-    </dependency>
-    <dependency>
-      <groupId>org.clojure</groupId>
-      <artifactId>math.numeric-tower</artifactId>
-      <version>0.0.4</version>
-    </dependency>
   </dependencies>
   <build>
     <sourceDirectory>src</sourceDirectory>
diff --git a/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/core.clj b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/core.clj
new file mode 100644
index 0000000000..296c2c6051
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/core.clj
@@ -0,0 +1,12 @@
+(ns tw.weekly.c90.core
+  (:require [tw.weekly.c90.t1 :as t1])
+  (:require [tw.weekly.c90.t2 :as t2])
+  (:gen-class))
+
+(defn -main
+  "Run all tasks"
+  [& _]
+  (println "Task #1:")
+  (t1/-main)
+  (println "\nTask #2:")
+  (t2/-main))
diff --git a/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t1.clj b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t1.clj
new file mode 100644
index 0000000000..e739241345
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t1.clj
@@ -0,0 +1,28 @@
+(ns tw.weekly.c90.t1
+  (:require [clojure.string :as str])
+  (:require [clojure.pprint :refer [cl-format]])
+  (:require [clojure.edn :as edn]))
+
+;;;
+; Task description for TASK #1 › DNA Sequence
+;;;
+
+(def DEFAULT-DNA
+  "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG")
+
+(defn process-dna
+  "Process the DNA sequence, counting nucleiobases and determining the
+  complementary sequence."
+  [dna]
+  (let [complement-dna (fn [s] (str/escape s {\T \A, \A \T, \C \G, \G \C}))]
+    ((juxt frequencies complement-dna) dna)))
+
+(defn -main
+  "Run Task 1 with a given DNA sequence, defaulting to the example given in
+  the task description."
+  [& args]
+  (let [dna (or (some-> args first edn/read-string) DEFAULT-DNA)
+        [freqs complement-seq] (process-dna dna)]
+    (cl-format true "~12a: ~a~%~12a: ~a~%"
+               "Counts" freqs
+               "Complement" complement-seq)))
diff --git a/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t2.clj b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t2.clj
new file mode 100644
index 0000000000..ab767f91fc
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/src/tw/weekly/c90/t2.clj
@@ -0,0 +1,22 @@
+(ns tw.weekly.c90.t2
+  (:require [clojure.edn :as edn]))
+
+;;;
+; Task description for TASK #2 › Ethiopian Multiplication
+;;;
+
+(defn ethiopian-multiply
+  "Compute the product of two positive integers using Ethiopian Multiplication."
+  [a b]
+  (let [source (map vector (iterate #(quot % 2) a) (iterate #(* 2 %) b))
+        xf (comp
+             (take-while (fn [[a _]] (pos? a)))
+             (keep (fn [[a b]] (when (odd? a) b))))]
+    (transduce xf + source)))
+
+(defn -main
+  "Run Task 2 with the given positive integers, defaulting to the example
+  given in the explanation page linked from the task description."
+  [& args]
+  (let [[A B] (or (some->> args (take 2) (map edn/read-string)) [12 14])]
+    (println (ethiopian-multiply A B))))
diff --git a/challenge-090/tyler-wardhaugh/clojure/test/tw/weekly/c90_test.clj b/challenge-090/tyler-wardhaugh/clojure/test/tw/weekly/c90_test.clj
new file mode 100644
index 0000000000..a09788f137
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/clojure/test/tw/weekly/c90_test.clj
@@ -0,0 +1,16 @@
+(ns tw.weekly.c90-test
+  (:require [clojure.test :refer [deftest is testing]]
+            [tw.weekly.c90.t1 :refer [DEFAULT-DNA process-dna]]
+            [tw.weekly.c90.t2 :refer [ethiopian-multiply]]))
+
+(def COMPLEMENT-DEFAULT-DNA
+  "CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC")
+
+(deftest task-1
+  (testing "Task 1, DNA Sequence"
+    (is (= [{\G 13, \T 22, \A 14, \C 18}, COMPLEMENT-DEFAULT-DNA]
+           (process-dna DEFAULT-DNA)))))
+
+(deftest task-2
+  (testing "Task 2, Ethiopian Multiplication"
+    (is (= 168 (ethiopian-multiply 12 14)))))