added Prolog solutions

5 files changed, 71 insertions, 0 deletions

diff --git a/challenge-090/adam-russell/blog1.txt b/challenge-090/adam-russell/blog1.txt
new file mode 100644
index 0000000000..57006d0158
--- /dev/null
+++ b/challenge-090/adam-russell/blog1.txt
@@ -0,0 +1 @@
+www.rabbitfarm.com/cgi-bin/blosxom/prolog/2020/12/13
diff --git a/challenge-090/adam-russell/prolog/ch-1 b/challenge-090/adam-russell/prolog/ch-1
new file mode 100755
index 0000000000..2a2e015671
--- /dev/null
+++ b/challenge-090/adam-russell/prolog/ch-1
diff --git a/challenge-090/adam-russell/prolog/ch-1.p b/challenge-090/adam-russell/prolog/ch-1.p
new file mode 100644
index 0000000000..ef0313b5be
--- /dev/null
+++ b/challenge-090/adam-russell/prolog/ch-1.p
@@ -0,0 +1,38 @@
+/*
+* Write a script to print nucleiobase count in the given DNA sequence. 
+* Also, print the complementary sequence where Thymine (T) on one strand 
+* is always facing an adenine (A) and vice versa; guanine (G) is always 
+* facing a cytosine (C) and vice versa.
+*/ 
+
+:- initialization(main).
+
+nucleotide_pair('A', 'T').
+nucleotide_pair('C', 'G').
+
+compliment([H|T], [Compliment|RestOfCompliment]):-
+    var(Compliment), 
+    atom_chars(A, [H]),  
+    (nucleotide_pair(A, X); nucleotide_pair(X, A)),    
+    atom_chars(X, [Compliment]),  
+    compliment(T, RestOfCompliment).  
+compliment([H|T], [Compliment|RestOfCompliment]):-
+    (nucleotide_pair(A, Compliment); nucleotide_pair(Compliment, A)),    
+    atom_chars(A, [H]),  
+    compliment(T, RestOfCompliment).  
+compliment([], _). 
+compliment(_, []). 
+
+main:-
+    Sequence = 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG',
+    atom_chars(Sequence, SequenceChars),
+    length(SequenceChars, SequenceLength),
+    format("Sequence length is ~d.~n", [SequenceLength]),
+    length(Compliment, SequenceLength), 
+    compliment(SequenceChars, Compliment),
+    atom_chars(ACompliment, Compliment),
+    compliment(OriginalSequence, Compliment),
+    atom_chars(AOriginalSequence, OriginalSequence),
+    format("Original sequence is ~a.~n", [AOriginalSequence]),
+    format("Complimentary sequence is ~a.~n", [ACompliment]),
+    halt.  
diff --git a/challenge-090/adam-russell/prolog/ch-2 b/challenge-090/adam-russell/prolog/ch-2
new file mode 100755
index 0000000000..39004fbbda
--- /dev/null
+++ b/challenge-090/adam-russell/prolog/ch-2
diff --git a/challenge-090/adam-russell/prolog/ch-2.p b/challenge-090/adam-russell/prolog/ch-2.p
new file mode 100644
index 0000000000..cf0ceb67d2
--- /dev/null
+++ b/challenge-090/adam-russell/prolog/ch-2.p
@@ -0,0 +1,32 @@
+/*
+* You are given two positive numbers A and B.
+* Write a script to demonstrate Ethiopian Multiplication 
+* using the given numberss
+*/ 
+
+:- initialization(main).
+
+ethiopean_multiplication(Operands, Product):-
+    ethiopean_multiplication(Operands, [], Product).
+ethiopean_multiplication([1, _], IntermediateTerms, Product):-
+    sum_list(IntermediateTerms, Product).
+ethiopean_multiplication(Operands, IntermediateTerms, Product):-
+    [A0, B0] = Operands,
+    A is A0 div 2,
+    B is B0 * 2,
+    M is A mod 2,
+    M == 1,
+    ethiopean_multiplication([A, B], [B|IntermediateTerms], Product).
+ethiopean_multiplication(Operands, IntermediateTerms, Product):-
+    [A0, B0] = Operands,
+    A is A0 div 2,
+    B is B0 * 2,
+    M is A mod 2,
+    M == 0,
+    ethiopean_multiplication([A, B], IntermediateTerms, Product).
+
+main:-
+    [A, B] = [14, 12],
+    ethiopean_multiplication([A, B], Product),
+    format("Product of ~d x ~d (via Ethiopean Multiplication) is ~d.~n", [A, B, Product]),
+    halt.