diff options
| author | Mohammad S Anwar <Mohammad.Anwar@yahoo.com> | 2020-12-20 03:02:22 +0000 |
|---|---|---|
| committer | GitHub <noreply@github.com> | 2020-12-20 03:02:22 +0000 |
| commit | eb8e80a19dddc78fb54d2ec7e81f70b109fd4db6 (patch) | |
| tree | 192b1e23afd36853fc34bcffaa33717570e8887e /challenge-090 | |
| parent | 9497da43344c9707130b090ffd0cf0750fab7f33 (diff) | |
| parent | 4f6f5798d369ab3ea629c771dea349b84a9be23d (diff) | |
| download | perlweeklychallenge-club-eb8e80a19dddc78fb54d2ec7e81f70b109fd4db6.tar.gz perlweeklychallenge-club-eb8e80a19dddc78fb54d2ec7e81f70b109fd4db6.tar.bz2 perlweeklychallenge-club-eb8e80a19dddc78fb54d2ec7e81f70b109fd4db6.zip | |
Merge pull request #3014 from pauloscustodio/090-gforth
Challenge 090 solution in gforth
Diffstat (limited to 'challenge-090')
| -rw-r--r-- | challenge-090/paulo-custodio/gforth/ch-1.fth | 40 | ||||
| -rw-r--r-- | challenge-090/paulo-custodio/gforth/ch-2.fth | 21 | ||||
| -rw-r--r-- | challenge-090/paulo-custodio/gforth/test.pl | 15 |
3 files changed, 76 insertions, 0 deletions
diff --git a/challenge-090/paulo-custodio/gforth/ch-1.fth b/challenge-090/paulo-custodio/gforth/ch-1.fth new file mode 100644 index 0000000000..fa8e29dfba --- /dev/null +++ b/challenge-090/paulo-custodio/gforth/ch-1.fth @@ -0,0 +1,40 @@ +\ Challenge 090 +\ TASK #1 › DNA Sequence +\ Submitted by: Mohammad S Anwar +\ DNA is a long, chainlike molecule which has two strands twisted into a double helix. +\ The two strands are made up of simpler molecules called nucleotides. Each nucleotide is +\ composed of one of the four nitrogen-containing nucleobases cytosine (C), guanine (G), +\ adenine (A) and thymine (T). +\ +\ You are given DNA sequence, +\ GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG. +\ +\ Write a script to print nucleiobase count in the given DNA sequence. Also print the +\ complementary sequence where Thymine (T) on one strand is always facing an adenine (A) +\ and vice versa; guanine (G) is always facing a cytosine (C) and vice versa. + +\ start with sequence in input buffer + +: compl-one ( c -- c ) + DUP 'T' = IF DROP 'A' + ELSE DUP 'A' = IF DROP 'T' + ELSE DUP 'G' = IF DROP 'C' + ELSE DUP 'C' = IF DROP 'G' + ELSE DROP BL + THEN THEN THEN THEN +; + +: compl-seq ( c-addr n -- c-addr n ) + PAD C! + PAD 1+ PAD C@ CMOVE \ copy as counted string to PAD + PAD 1+ + PAD C@ 0 DO + DUP C@ compl-one OVER C! 1+ + LOOP + PAD COUNT +; + +next-arg \ collect string +DUP . CR \ print length +compl-seq TYPE CR \ print complemented sequence +BYE diff --git a/challenge-090/paulo-custodio/gforth/ch-2.fth b/challenge-090/paulo-custodio/gforth/ch-2.fth new file mode 100644 index 0000000000..2f949db3db --- /dev/null +++ b/challenge-090/paulo-custodio/gforth/ch-2.fth @@ -0,0 +1,21 @@ +\ Challenge 090 +\ TASK #2 › Ethiopian Multiplication +\ Submitted by: Mohammad S Anwar +\ You are given two positive numbers $a and $b. +\ +\ Write a script to demonstrate Ethiopian Multiplication using the given numbers. + +: mult { a b -- a*b } \ a, b: locals + 0 ( sum ) + BEGIN + a 1 AND IF \ a is even + b + \ sum += b + THEN + a 1 = IF EXIT THEN \ exit when a=1 + a 2/ TO a + b 2* TO b + AGAIN +; + +\ input in stack +mult . CR BYE diff --git a/challenge-090/paulo-custodio/gforth/test.pl b/challenge-090/paulo-custodio/gforth/test.pl new file mode 100644 index 0000000000..278659d91f --- /dev/null +++ b/challenge-090/paulo-custodio/gforth/test.pl @@ -0,0 +1,15 @@ +#!/usr/bin/env perl + +use strict; +use warnings; +use Test::More; + +is `gforth ch-1.fth \\ +GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG`, <<'END'; +67 +CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC +END + +is `gforth -e '14 12' ch-2.fth`, "168 \n"; + +done_testing; |
