3 files changed, 50 insertions, 0 deletions
diff --git a/challenge-090/adam-russell/blog.txt b/challenge-090/adam-russell/blog.txt
new file mode 100644
index 0000000000..e69de29bb2
--- /dev/null
+++ b/challenge-090/adam-russell/blog.txt
diff --git a/challenge-090/adam-russell/perl/ch-1.pl b/challenge-090/adam-russell/perl/ch-1.pl
new file mode 100644
index 0000000000..382f19295f
--- /dev/null
+++ b/challenge-090/adam-russell/perl/ch-1.pl
@@ -0,0 +1,27 @@
+use strict;
+use warnings;
+##
+# Write a script to print  the nucleiobase count in
+# the given DNA sequence. Also print the complementary 
+# sequence where Thymine (T) on one strand is always 
+# facing an adenine (A) and vice versa; guanine (G) is 
+# always facing a cytosine (C) and vice versa.
+##
+use constant SEQUENCE => "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG";
+my %nucleotide_map = (
+    "T" => "A", 
+    "A" => "T", 
+    "G" => "C", 
+    "C" => "G" 
+);    
+
+sub complementary_sequence{
+    my($sequence) = @_;
+    my @complement = map { $nucleotide_map{$_} } split(//, $sequence);
+    return @complement; 
+} 
+
+MAIN:{
+    print "length of sequence: " . length(SEQUENCE) . "\n";
+    print "complementary sequence: " . join("", complementary_sequence(SEQUENCE)) . "\n";      
+} 
diff --git a/challenge-090/adam-russell/perl/ch-2.pl b/challenge-090/adam-russell/perl/ch-2.pl
new file mode 100644
index 0000000000..6d5d0a4852
--- /dev/null
+++ b/challenge-090/adam-russell/perl/ch-2.pl
@@ -0,0 +1,23 @@
+use strict;
+use warnings;
+##
+# You are given two positive numbers $A and $B.
+# Write a script to demonstrate Ethiopian Multiplication 
+# using the given numbers.
+##
+sub ethiopian_multiplication{
+    my($a, $b) = @_;
+    my @steps;
+    my ($x, $y) = ($a, $b); 
+    do{
+        $x = int($x / 2);
+        $y = $y * 2;
+print "$x $y\n"; 
+        push @steps, [$x, $y];
+    }until $steps[-1]->[0] == 1 || $steps[-1]->[1] == 1; 
+}
+
+MAIN:{
+    my($A, $B) = (14, 12);
+    ethiopian_multiplication($A, $B);
+}