4 files changed, 83 insertions, 0 deletions
diff --git a/challenge-090/nunovieira220/js/ch-1.js b/challenge-090/nunovieira220/js/ch-1.js
new file mode 100644
index 0000000000..16e2b55cdc
--- /dev/null
+++ b/challenge-090/nunovieira220/js/ch-1.js
@@ -0,0 +1,20 @@
+// Input
+const sequence = "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG";
+
+// DNA Sequence
+const convert = {'T': 'A', 'A': 'T', 'G': 'C', 'C': 'G'};
+const counters = {'A': 0, 'C': 0, 'G': 0, 'T': 0};
+let complementary = '';
+
+sequence.split('').forEach(base => {
+  counters[base]++;
+  complementary += convert[base];
+});
+
+// Output
+const { A, C, G, T } = counters;
+console.log(`Adenine: ${A}`);
+console.log(`Cytosine: ${C}`);
+console.log(`Guanine: ${G}`);
+console.log(`Thymine: ${T}`);
+console.log(`Complementary: ${complementary}`);
+\ No newline at end of file
diff --git a/challenge-090/nunovieira220/js/ch-2.js b/challenge-090/nunovieira220/js/ch-2.js
new file mode 100644
index 0000000000..f37bef53cb
--- /dev/null
+++ b/challenge-090/nunovieira220/js/ch-2.js
@@ -0,0 +1,15 @@
+// Input
+let A = 14;
+let B = 12;
+
+// Ethiopian Multiplication
+let res = 0;
+
+while(A > 1) {
+  A = Math.floor(A / 2);
+  B = B * 2;
+  res += B;
+}
+
+// Output
+console.log(res);
+\ No newline at end of file
diff --git a/challenge-090/nunovieira220/perl/ch-1.pl b/challenge-090/nunovieira220/perl/ch-1.pl
new file mode 100644
index 0000000000..0f61d11db5
--- /dev/null
+++ b/challenge-090/nunovieira220/perl/ch-1.pl
@@ -0,0 +1,26 @@
+#!/usr/bin/perl
+
+use strict;
+use warnings;
+use feature qw(say);
+use Data::Dumper;
+
+# Input
+my $sequence = "GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG";
+
+# DNA Sequence
+my %convert = ('T', 'A', 'A', 'T', 'G', 'C', 'C', 'G');
+my %counters = ('A', 0, 'C', 0, 'G', 0, 'T', 0);
+my $complementary = '';
+
+for (split('', $sequence)) {
+  $counters{$_}++;
+  $complementary .= $convert{$_};
+}
+
+# Output
+say "Adenine: ".$counters{'A'};
+say "Cytosine: ".$counters{'C'};
+say "Guanine: ".$counters{'G'};
+say "Thymine: ".$counters{'T'};
+say "Complementary: ".$complementary;
+\ No newline at end of file
diff --git a/challenge-090/nunovieira220/perl/ch-2.pl b/challenge-090/nunovieira220/perl/ch-2.pl
new file mode 100644
index 0000000000..ea272fe60c
--- /dev/null
+++ b/challenge-090/nunovieira220/perl/ch-2.pl
@@ -0,0 +1,22 @@
+#!/usr/bin/perl
+
+use strict;
+use warnings;
+use feature qw(say);
+use POSIX;
+
+# Input
+my $A = 14;
+my $B = 12;
+
+# Ethiopian Multiplication
+my $res = 0;
+
+while($A > 1) {
+  $A = floor($A / 2);
+  $B = $B * 2;
+  $res += $B;
+}
+
+# Output
+say $res;
+\ No newline at end of file