diff options
| -rwxr-xr-x | challenge-090/wlmb/perl/ch-1.pl | 64 | ||||
| -rwxr-xr-x | challenge-090/wlmb/perl/ch-2.pl | 40 |
2 files changed, 104 insertions, 0 deletions
diff --git a/challenge-090/wlmb/perl/ch-1.pl b/challenge-090/wlmb/perl/ch-1.pl new file mode 100755 index 0000000000..00e54fa1e0 --- /dev/null +++ b/challenge-090/wlmb/perl/ch-1.pl @@ -0,0 +1,64 @@ +#!/usr/bin/env perl +# For sequences of DNA get nucleotide counts and its complement + +use strict; +use warnings; +use v5.10; + +use List::Util qw(sum0); + +# Receive sequences as strings in @ARGV +say('Usage: ch-1.pl sequence1 sequence2 ...'), exit 1 unless @ARGV; + +my %complement_of; # Map dna nucleotide to its complement +@complement_of{my @nucleotides=qw(T A G C)}=qw(A T C G); #initialize + +foreach my $sequence(map {uc} @ARGV){ + say("Wrong sequence $sequence"), next unless $sequence=~/^[@nucleotides]*$/; + say " Sequence: $sequence"; + say "Complement: ", complement($sequence); + my %count_for=get_count_for($sequence); + say "Nucleotide counts:"; + say "\t$_-$complement_of{$_} $count_for{$_}" for @nucleotides; + say "\tTotal\t", sum0 values %count_for; +} + +sub complement { # converts string with a DNA sequence to its complement + my $sequence=shift; + return join "", map {$complement_of{$_}} split //, $sequence; +} + +sub get_count_for { # count nucleotides of a dna sequence + my $sequence=shift; + my @nucleotides=split //,$sequence; + my %count_for; # counts of nucleotides + @count_for{split //, "TAGC"}=((0) x 4); #initialize with 0's + map {$count_for{$_}++} split //, $sequence; + return %count_for; +} + +# Sample run: +# +# $ ./ch-1.pl hithere \ +# GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG \ +# TGCTGGTCGCCG +# +# yields: +# +# Wrong sequence HITHERE +# Sequence: GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG +# Complement: CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC +# Nucleotide counts: +# T-A 22 +# A-T 14 +# G-C 13 +# C-G 18 +# Total 67 +# Sequence: TGCTGGTCGCCG +# Complement: ACGACCAGCGGC +# Nucleotide counts: +# T-A 3 +# A-T 0 +# G-C 5 +# C-G 4 +# Total 12 diff --git a/challenge-090/wlmb/perl/ch-2.pl b/challenge-090/wlmb/perl/ch-2.pl new file mode 100755 index 0000000000..6be0c0de39 --- /dev/null +++ b/challenge-090/wlmb/perl/ch-2.pl @@ -0,0 +1,40 @@ +#!/usr/bin/env perl +# Multiply two numbers using the Ethiopian Multiplication + +use strict; +use warnings; +use v5.10; +use integer; +use List::Util qw(all); + +# receive the two numbers in @ARGV +die 'Usage: ./ch2.pl number1 number2' unless @ARGV==2; +my ($x, $y)=@ARGV; +die 'Expected two non-negative integers' # check signs + unless all {int($_)==$_ && $_>=0} ($x, $y); +my $expected_result=$x*$y; +my $result=0; +my $result_string="$x x $y = "; +my $operator=""; +while($x){ + if($x&1){ # $x is odd, add $y to result + print "->"; # flag line + $result += $y; + $result_string .= "$operator 1 x $y"; + } else { # $x is even, don't add y + $result_string.="$operator 0 x $y"; + } + say "\t$x\t$y"; + $operator=" + "; + $x>>=1; # Divde $x by 2 + $y<<=1; # Multiply $y by 2 +} +say " $result_string = $result (Expected: $expected_result)"; + +# Sample run: +# $ ./ch-2.pl 11 23 +# -> 11 23 +# -> 5 46 +# 2 92 +# -> 1 184 +# 11 x 23 = 1 x 23 + 1 x 46 + 0 x 92 + 1 x 184 = 253 (Expected: 253) |