1 files changed, 44 insertions, 0 deletions
diff --git a/challenge-090/jcrosswh/perl/ch-1.pl b/challenge-090/jcrosswh/perl/ch-1.pl
new file mode 100644
index 0000000000..098fbf1f79
--- /dev/null
+++ b/challenge-090/jcrosswh/perl/ch-1.pl
@@ -0,0 +1,44 @@
+#!/usr/bin/env perl
+
+use strict;
+use warnings;
+
+=head1 NAME
+
+PWC 090 Challenge 1
+
+=head1 SYNOPSIS
+
+  $ ch-1.pl
+  67
+  CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC
+
+=head1 DESCRIPTION
+
+Given the DNA sequence,
+GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG, this script
+prints the nucleiobase count in the DNA sequence.  This script also prints the
+complementary sequence where Thymine (T) on one strand is always facing an
+adenine (A) and vice versa; guanine (G) is always facing a cytosine (C) and vice
+versa.
+
+=head1 AUTHORS
+
+Joel Crosswhite E<lt>joel.crosswhite@ix.netcom.comE<gt>
+
+=cut
+
+my $DNA_SEQUENCE = 
+    'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG';
+my %dna_complement = (
+    'A' => 'T',
+    'T' => 'A',
+    'C' => 'G',
+    'G' => 'C'
+);
+
+print length($DNA_SEQUENCE) . " bases\n";
+print map { $dna_complement{$_} } split(//, $DNA_SEQUENCE);
+print "\n";
+
+exit 0;
+\ No newline at end of file