1 files changed, 27 insertions, 0 deletions
diff --git a/challenge-090/paulo-custodio/python/ch-1.py b/challenge-090/paulo-custodio/python/ch-1.py
new file mode 100644
index 0000000000..0af71bfe29
--- /dev/null
+++ b/challenge-090/paulo-custodio/python/ch-1.py
@@ -0,0 +1,27 @@
+#!/usr/bin/env python
+
+# Challenge 090
+#
+# TASK #1 > DNA Sequence
+# Submitted by: Mohammad S Anwar
+# DNA is a long, chainlike molecule which has two strands twisted into a
+# double helix. The two strands are made up of simpler molecules called
+# nucleotides. Each nucleotide is composed of one of the four nitrogen-containing
+# nucleobases cytosine (C), guanine (G), adenine (A) and thymine (T).
+#
+# You are given DNA sequence,
+# GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG.
+#
+# Write a script to print nucleiobase count in the given DNA sequence.
+# Also print the complementary sequence where Thymine (T) on one strand
+# is always facing an adenine (A) and vice versa; guanine (G) is always
+# facing a cytosine (C) and vice versa.
+
+import sys
+import string
+
+seq = sys.argv[1]
+compl = seq.translate(str.maketrans("TAGC", "ATCG"))
+
+print(len(seq))
+print(compl)