1 files changed, 21 insertions, 0 deletions
diff --git a/challenge-090/tyler-wardhaugh/lua/test.lua b/challenge-090/tyler-wardhaugh/lua/test.lua
new file mode 100755
index 0000000000..7dffde2f53
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/test.lua
@@ -0,0 +1,21 @@
+#!/usr/bin/env lua
+
+require 'busted.runner'()
+
+describe("Task 1, DNA Sequence", function()
+  local t1 = require'ch-1'
+  it("produces correct results for the examples", function()
+    local freq, complement = t1.process_dna(t1.DEFAULT_DNA)
+    assert.are.same({G=13, T=22, A=14, C=18 }, freq)
+    assert.are.same('CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC',
+      complement)
+  end)
+end)
+
+describe("Task 2, Ethiopian Multiplication", function()
+  local t2 = require'ch-2'
+  it("produces correct results for the examples", function()
+    assert.are.same(168, t2.ethiopian_multiply(12, 14))
+    assert.are.same(1554, t2.ethiopian_multiply(37, 42))
+  end)
+end)