Merge branch 'master' of github.com:manwar/perlweeklychallenge-club

6 files changed, 109 insertions, 3 deletions

diff --git a/challenge-090/tyler-wardhaugh/lua/README.md b/challenge-090/tyler-wardhaugh/lua/README.md
index d2f91b15fe..8772dac9c1 100644
--- a/challenge-090/tyler-wardhaugh/lua/README.md
+++ b/challenge-090/tyler-wardhaugh/lua/README.md
@@ -1,17 +1,17 @@
 
 # The Weekly Challenge
 
-The Weekly Challenge - #089 - Tyler Wardhaugh
+The Weekly Challenge - #090 - Tyler Wardhaugh
 
 ## Usage
 
 Run Task 1:
 
-    $ ./run.lua ch-1 N
+    $ ./run.lua ch-1 DNA
 
 Run Task 2:
 
-    $ ./run.lua ch-2 MATRIX-FILE
+    $ ./run.lua ch-2 A B
 
 Run the project's tests (all the samples from the task descriptions plus some others):
 
diff --git a/challenge-090/tyler-wardhaugh/lua/ch-1.lua b/challenge-090/tyler-wardhaugh/lua/ch-1.lua
new file mode 100755
index 0000000000..e964ce9f6d
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/ch-1.lua
@@ -0,0 +1,35 @@
+#!/usr/bin/env lua
+
+local t1 = {}
+local util = require'util'
+
+t1.DEFAULT_DNA = 'GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG'
+
+function t1.process_dna(dna)
+  freq = {}
+  for c in dna:gmatch'.' do
+    freq[c] = (freq[c] or 0) + 1
+  end
+
+  local replacement = {A='T', T='A', C='G', G='C'}
+  local complement = dna:gsub('(%w)', function (c) return replacement[c] end)
+
+  return freq, complement
+end
+
+function t1.run(args)
+  local dna = args[1] or t1.DEFAULT_DNA
+  local freq, complement = t1.process_dna(dna)
+
+  io.write('Counts = { ')
+  local seq = util.dict_to_seq(freq)
+  for i, v in ipairs(seq) do
+    io.write(v[1] .. ': ' .. v[2])
+    if i ~= #seq then io.write(', ') end
+  end
+  print(' }\n')
+
+  print('Complement: ' .. complement)
+end
+
+return t1
diff --git a/challenge-090/tyler-wardhaugh/lua/ch-2.lua b/challenge-090/tyler-wardhaugh/lua/ch-2.lua
new file mode 100755
index 0000000000..85c69b7be8
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/ch-2.lua
@@ -0,0 +1,27 @@
+#!/usr/bin/env lua
+
+local t2 = {}
+
+function t2.ethiopian_multiply(a, b)
+  local product = 0
+
+  while a > 0 do
+    if a % 2 ~= 0 then
+      product = product + b
+    end
+
+    a = a // 2
+    b = b * 2
+  end
+
+  return product
+end
+
+function t2.run(args)
+  local A = tonumber(args[1]) or 12
+  local B = tonumber(args[2]) or 14
+  local product = t2.ethiopian_multiply(A, B)
+  print(product)
+end
+
+return t2
diff --git a/challenge-090/tyler-wardhaugh/lua/run.lua b/challenge-090/tyler-wardhaugh/lua/run.lua
new file mode 100755
index 0000000000..c6e7473bee
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/run.lua
@@ -0,0 +1,9 @@
+#!/usr/bin/env lua
+
+local filename = arg[1]
+local run_args = table.move(arg, 2, #arg, 1, {})
+
+io.write(string.format("Running task from '%s' with {%s}:\n",
+  filename, table.concat(run_args, ", ")))
+
+require(filename).run(run_args)
diff --git a/challenge-090/tyler-wardhaugh/lua/test.lua b/challenge-090/tyler-wardhaugh/lua/test.lua
new file mode 100755
index 0000000000..7dffde2f53
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/test.lua
@@ -0,0 +1,21 @@
+#!/usr/bin/env lua
+
+require 'busted.runner'()
+
+describe("Task 1, DNA Sequence", function()
+  local t1 = require'ch-1'
+  it("produces correct results for the examples", function()
+    local freq, complement = t1.process_dna(t1.DEFAULT_DNA)
+    assert.are.same({G=13, T=22, A=14, C=18 }, freq)
+    assert.are.same('CATTTGGGGAAAAGTAAATCTGTCTAGCTGAGGAATAGGTAAGAGTCTCTACACAACGACCAGCGGC',
+      complement)
+  end)
+end)
+
+describe("Task 2, Ethiopian Multiplication", function()
+  local t2 = require'ch-2'
+  it("produces correct results for the examples", function()
+    assert.are.same(168, t2.ethiopian_multiply(12, 14))
+    assert.are.same(1554, t2.ethiopian_multiply(37, 42))
+  end)
+end)
diff --git a/challenge-090/tyler-wardhaugh/lua/util.lua b/challenge-090/tyler-wardhaugh/lua/util.lua
new file mode 100644
index 0000000000..1623b04824
--- /dev/null
+++ b/challenge-090/tyler-wardhaugh/lua/util.lua
@@ -0,0 +1,14 @@
+#!/usr/bin/env lua
+
+util = {}
+
+--[[ table ]]--
+function util.dict_to_seq(coll)
+  local result = {}
+  for k, v in pairs(coll) do
+    table.insert(result, { k, v })
+  end
+  return result
+end
+
+return util