diff options
| author | dcw <d.white@imperial.ac.uk> | 2020-12-13 20:59:21 +0000 |
|---|---|---|
| committer | dcw <d.white@imperial.ac.uk> | 2020-12-13 20:59:21 +0000 |
| commit | 6f64a5ae8428f270d2a4f86330f3b89edf3a35ef (patch) | |
| tree | 83472056a6f0bd0b0b72bf1bc5a4754710ed5919 /challenge-090 | |
| parent | 931e28a9fe63ad0942cf9f3099191a0e21a978c2 (diff) | |
| download | perlweeklychallenge-club-6f64a5ae8428f270d2a4f86330f3b89edf3a35ef.tar.gz perlweeklychallenge-club-6f64a5ae8428f270d2a4f86330f3b89edf3a35ef.tar.bz2 perlweeklychallenge-club-6f64a5ae8428f270d2a4f86330f3b89edf3a35ef.zip | |
imported my solutions to this week's tasks
Diffstat (limited to 'challenge-090')
| -rw-r--r-- | challenge-090/duncan-c-white/README | 54 | ||||
| -rwxr-xr-x | challenge-090/duncan-c-white/perl/ch-1.pl | 53 | ||||
| -rwxr-xr-x | challenge-090/duncan-c-white/perl/ch-2.pl | 50 |
3 files changed, 128 insertions, 29 deletions
diff --git a/challenge-090/duncan-c-white/README b/challenge-090/duncan-c-white/README index a5b283e113..91b90f56ac 100644 --- a/challenge-090/duncan-c-white/README +++ b/challenge-090/duncan-c-white/README @@ -1,44 +1,40 @@ -Task 1: "GCD Sum +Task 1: "DNA Sequence -You are given a positive integer $N. -Write a script to sum GCD of all possible unique pairs between 1 and $N. +DNA is a long, chainlike molecule which has two strands twisted into +a double helix. The two strands are made up of simpler molecules +called nucleotides. Each nucleotide is composed of one of the four +nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A) +and thymine (T). -Example 1: +You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG. - Input: 3 - Output: 3 +Write a script to print nucleobase count in the given DNA sequence. Also +print the complementary sequence where Thymine (T) on one strand is +always facing an adenine (A) and vice versa; guanine (G) is always facing +a cytosine (C) and vice versa. - gcd(1,2) + gcd(1,3) + gcd(2,3) +To get the complementary sequence use the following mapping: -Example 2: - - Input: 4 - Output: 7 - - gcd(1,2) + gcd(1,3) + gcd(1,4) + gcd(2,3) + gcd(2,4) + gcd(3,4) +T => A +A => T +G => C +C => G " -My notes: very clearly defined. Haven't used GCDs for a while:-) +My notes: very clearly defined, simple to do. -Task 2: "Magical Matrix +Task 2: "Ethiopian Multiplication -Write a script to display matrix as below with numbers 1 - 9. Please make sure numbers are used once. +You are given two positive numbers $A and $B. -[ a b c ] -[ d e f ] -[ g h i ] +Write a script to demonstrate -So that it satisfies the following: +https://rosettacode.org/wiki/Ethiopian_multiplication -a + b + c = 15 -d + e + f = 15 -g + h + i = 15 -a + d + g = 15 -b + e + h = 15 -c + f + i = 15 -a + e + i = 15 -c + e + g = 15 +using the given numbers. " -My notes: clearly defined. Constraint problem. +My notes: clearly defined, once you follow the link and discover what Ethiopian Multiplication is:-) +Exercise for the interested reader: why does the method work? It follows directly from how BINARY +multiplication actually works. diff --git a/challenge-090/duncan-c-white/perl/ch-1.pl b/challenge-090/duncan-c-white/perl/ch-1.pl new file mode 100755 index 0000000000..ea0fb6e625 --- /dev/null +++ b/challenge-090/duncan-c-white/perl/ch-1.pl @@ -0,0 +1,53 @@ +#!/usr/bin/perl +# +# Task 1: "DNA Sequence +# +# DNA is a long, chainlike molecule which has two strands twisted into +# a double helix. The two strands are made up of simpler molecules +# called nucleotides. Each nucleotide is composed of one of the four +# nitrogen-containing nucleobases cytosine (C), guanine (G), adenine (A) +# and thymine (T). +# +# You are given DNA sequence, GTAAACCCCTTTTCATTTAGACAGATCGACTCCTTATCCATTCTCAGAGATGTGTTGCTGGTCGCCG. +# +# Write a script to print nucleobase count in the given DNA sequence. Also +# print the complementary sequence where Thymine (T) on one strand is +# always facing an adenine (A) and vice versa; guanine (G) is always facing +# a cytosine (C) and vice versa. +# +# To get the complementary sequence use the following mapping: +# +# T => A +# A => T +# G => C +# C => G +# " +# +# My notes: very clearly defined, simple to do. +# + +use strict; +use warnings; +use feature 'say'; +use Getopt::Long; +use Data::Dumper; + +my $debug = 0; +die "Usage: dna [--debug] sequence\n" unless + GetOptions( "debug" => \$debug ) && + @ARGV==1; +my $seq = shift; + +my %freq; +my $comp = ""; +my %comp = qw(T A A T G C C G); +@freq{keys %comp} = (0) x (keys %comp); + +$seq =~ tr/ATCG//cd; +foreach my $base (split(//,$seq)) +{ + $freq{$base}++; + $comp .= $comp{$base}; +} +say "complement: $comp"; +say "freq{$_} = $freq{$_}" for sort keys %comp; diff --git a/challenge-090/duncan-c-white/perl/ch-2.pl b/challenge-090/duncan-c-white/perl/ch-2.pl new file mode 100755 index 0000000000..8cabeac23f --- /dev/null +++ b/challenge-090/duncan-c-white/perl/ch-2.pl @@ -0,0 +1,50 @@ +#!/usr/bin/perl +# +# Task 2: "Ethiopian Multiplication +# +# You are given two positive numbers $A and $B. +# +# Write a script to demonstrate +# https://rosettacode.org/wiki/Ethiopian_multiplication +# using the given numbers. +# " +# +# My notes: clearly defined, once you follow the link and discover what Ethiopian Multiplication is:-) +# Exercise for the interested reader: why does the method work? It follows directly from how BINARY +# multiplication actually works. +# + +use strict; +use warnings; +use Data::Dumper; +use Function::Parameters; +use feature 'say'; +use Getopt::Long; + +my $debug = 0; +die "Usage: ethiopian-multiplication [--debug] A B\n" unless + GetOptions( "debug" => \$debug ) && + @ARGV==2; +my( $a, $b ) = @ARGV; + +say ethiopian( $a, $b ); + + +# +# my $m = ethiopian( $a, $b ); +# Use Ethiopian Multiplication - the original Egyptian/Ethiopian/Russian +# form of multiplication using repeated doublings and halvings. +# +fun ethiopian( $a, $b ) +{ + my $r = 0; + while( $a >= 1 ) + { + say "r:$r, a:$a, b:$b" if $debug; + $r += $b if $a % 2 == 1; + $a /= 2; $a = int($a); + $b *= 2; + } + say "r:$r, a:$a, b:$b" if $debug; + return $r; +} |
